மனிதன்: அல்லாவின் அருளா? பரிணாமத்தின் பரிசா? 4

இத்தொடரின் முந்தைய பகுதிகள்

34. மனிதன்: அல்லாவின் அருளா? பரிணாமத்தின் பரிசா? 3

33. மனிதன்: அல்லாவின் அருளா? பரிணாமத்தின் பரிசா? 2

32. மனிதன்: அல்லாவின் அருளா? பரிணாமத்தின் பரிசா? 1

31. ஸம் ஸம் நீரூற்றும் குரானும்

30. விண்வெளியைக் கடந்த முதல் மனிதர் முகம்மதின் மிஹ்ராஜ்

29. மீனின் வயிற்றில் மனிதனைப் பாதுகாத்த அல்லா

28. குரான் குறிப்பிடும் பேசும் உயிரினங்கள் இருப்பது சாத்தியமா?

27. தடயமில்லாத அல்லாவின் அத்தாட்சிகள்

26. குரானில் மிதக்கும் சின்னச் சின்னப் பிழைகள்

25. நிலவை உடைத்து ஒட்டிய அல்லா

24. ஆதிமனிதன் மொழியறிந்தவனா? அல்லாவின் பதில் என்ன?

23. கால வெளியில் சிக்கிக்கொண்ட அல்லா

22. குரானின் காலப்பிழைகள்

21. குரான் குறிப்பிடும் நட்சத்திரங்கள்: மனிதப் பார்வையா? இறைப் பார்வையா?

20. மக்காவின் பாதுகாப்பு: குரானின் அறிவிப்புகள் உண்மையா?

19. சூரத்துல் கஹ்புக்கும் புத்தருக்கும் என்ன தொடர்பு?

18. நூஹின் கப்பல் நிறைய புராணப் புழுகுகள்

17. பிர் அவ்னின் உடல் எனும் கட்டுக்கதை

16. கருவறை குறித்த அல்லாவின் கதையாடல்கள்

15. விந்து குறித்த குரானின் விந்தைகள்

14. பாலும் தேனும் அல்லாவின் வேதத்தின் பாடுகள்

13. கோள்களும் அதன் விசையும் அல்லாவின் தேற்றங்கள்

12. விண்வெளி குறித்த அல்லாவின் பண்வெளிகள்.

11. குரானின் மலையியல் மயக்கங்கள்

10. கடல்கள் பற்றிய அல்லாவின் புனைகதைகள்

9. பூமி உருண்டை என யார் சொன்னது, அல்லாவா? மனிதனா?

8. பிரபஞ்சமும் அதை கட்டுப்பட அழைத்த குரானும்

7. குரான் கூறுவது அறிவியலாகுமா?

6. ஹதீஸ்களும் அதன் பிரச்சனைகளும்.

5. குரானின் பாதுகாப்பில் விழுந்த கேள்விக்குறிகள்.

4. மெய்யாகவே குரான் பாதுகாக்கப்பட்டது தானா?

3. குரானின் சவாலுக்கு பதில்

2. அல்லாவின் ஆற்றலிலுள்ள இடர்பாடுகள்

1. இஸ்லாம். பிறப்பும் இருப்பும்: ஓர் எளிய அறிமுகம்

இஸ்லாம்: கற்பனைக்கோட்டையின் விரிசல்கள் வழியே….

மின்னூலாக(PDF) தரவிறக்க‌

78 பதில்கள்

  1. குரானின் பலம்& பல்வீனமே அது வரிசைகிரமாக இல்லாததுதான்.ஆகவே தொடர்ச்சியாக் இப்படி நட்ந்தது என்றோ நடக்கவில்லை என்றோ கூற இயலாது.
    மொழி பெயர்ப்பு சித்து வேலைகளும்,அடைப்புக் குறிகளும் போட்டு ஒரு திறமையான பிரச்சாரகர் எந்த விளக்கமும் கொடுக்க முடியும்.

    இந்த இரு வசனங்க்களில் குறிப்பிடப் படுவது ஆதம் என்ற மனிதனா என்று உறுதியாக் குரானில் இருந்து மட்டும் கூற முடியாது.
    (7.189)&(39.6)இரு வசனமுமே ஒன்றே.எதற்கு திருப்பி சொல்ல வேண்டும்?

    இந்த இரு வசனமுமே ஆத்மா என்றே குறிப்பிடுகின்றன்.அதன் துணை அல்லது இணை அதில் இருந்து படைக்கப் பட்டதாகவும் கூறுகின்றன.
    ­­­­­­­­­­­­­­­­­­­­­­_________________________
    (7:189:5)nafsin=a soul,=ஆத்மா
    (7:189:9) zawjahā=its mate=அதன் து(இ)ணை
    _________
    (39:6:3) nafsin=a soul=ஆத்மா
    (39:6:8) zawjahā =its mate=அதன் து(இ)ணை
    _________
    குரான் 32.7 மாதிரி சில வசனங்கள் மனிதன் களிமண்ணில் இருந்து படைக்கப் பட்டதாக் கூறுகின்றன.
    ஆதம் என்பது பைபிளில் இருந்து கூறப்பட்டிருக்க வேண்டும்.அவர் மனைவி பெயர் குரனில் இல்லை.

  2. செங்கொடி sir
    படைப்பு கொள்கை நம்பிக்கை சார்ந்தது. அதில் அறிவியல் இல்லை. மனித சமுதாயம் முழுவதும் ஒரேஒரு மனிதனிலிருந்து வந்தது என்று குரான் தெளிவாக கூறி இருக்கிறது.இவ்வாறு நம்பினால் எந்த ஒரு மனிதன் மற்றவனை விட உயர்ந்தவனோ , தாழ்ந்தவனோ கிடையாது எல்லோருமே சமம், எல்லோருமே சகோதரர்கள் என்ற உயர்ந்த கொள்கை உருவாகும்.பரிணாம கொள்கை அறிவியல் ( !!!!!!!!!!) பூர்வமானது என்று வாதிடும் நீங்கள் அந்த கொள்கையில் உள்ள ஓட்டை களை புறந்தள்ளுவது ஏன்?இந்த பரிணாம கொள்கைகளின் அபத்தங்களை தங்களது பதிவுகளின் மூலம் வெளிக்கொணர்ந்த சகோ கள் ஆஷிக் அஹ்மத் , கார்பன் கூட்டாளி , குலாம் ஆகியோரின் பரிணாம கொள்கை பற்றிய நியாய மான கேள்விகளுக்கு சரியான பதில் எந்த பதிவரும் சொல்லவில்லை.

  3. உங்களுடைய விருப்பங்கள் மற்றவர்களின் முடிவுகளாய் இருக்கவேண்டும் என்ற உங்களின் வாதம் அபத்தமானதல்லவா?????????
    உங்களின் வினாக்களுக்கும் ஐயங்களுக்கும் வரிக்கு வரி பதில் எதிர்பார்ப்பது மடமைத்தனம். நம்பிக்கை சார்ந்த விசயங்களை யார் வேண்டுமானாலும் விமர்சிக்க முடியும். அனால் அதன் உண்மையான யதார்த்தங்கள் அந் நம்பிக்கையாளர்களுக்கு மட்டுமே விளங்கும்.
    உதாரணத்திற்கு : மூன்று பேரின் மரணதண்டனையை ரத்து செய்யக்கோரி போராடும் போராட்டங்கள் அதன் அர்த்தங்கள் எப்படி வெற்றி என்ற நம்பிக்கையின் பாற்பட்டு எதிர்நோக்கி இருக்கின்றதோ அதுபோலத்தான் மறுமை என்ற நம்பிக்கையின் எதிர்ப்பட்டு எம் செயல்களும் எம் நம்பிக்கைகளும் இருக்கின்றது.
    செங்கொடியின் தற்கொலைக்கு அர்த்தம் கற்பிக்கும் உங்களின் தோழர்கள் வாழ்வில் நம்பிக்கையின் தோல்வி எஞ்சி நிற்பதை அவள்சடலத்தின் வழி காண முடிகின்றது.

  4. தீர்வு கிடைக்கும் என்ற நம்பிக்கையின் எதிரபார்ப்பாய் உங்களின் சாவுகள் இருக்கும்போது, அதே நம்பிக்கையின் கண்ணியமான வாழ்வாய் எங்களின் வாழ்தல்கள் (வாழ்க்கை) இருக்கக்கொடாதா என்ன?????????

  5. என்னே செங்கோடியாரே நான் எழுதி இருப்பதற்கும் இவர் சொல்லும் வாதத்திற்கும் சம்பந்தம் இல்லை என்பது போல் உங்களுக்கு தோன்றினாலும் என் எழுத்துக்களின் உள்ளார்ந்த அர்த்தங்கள் செங்கொடியின் சாவினைப்போலவே பல அர்த்தம் கொண்டது…
    செங்கொடியின் சாவில் அநியாயம் கற்பிக்கும் மற்றவர்களின் அறிவை எப்படி உங்களால் எடுத்துக்கொள்ள முடியாதோ அதுபோலவே உங்களின் தெளிவற்ற இன்னும் உங்களின் அறிவு அடைந்திராத இந்த பரிணாமம் படைப்பு பற்றிய உங்களின் வாதங்கள் எங்களாலும் சகித்துக்கொள்ள முடியாது.
    இன்னும் அறிவியல் அடைந்திராத பதார்த்தங்கள் ஏராளம்.
    உங்களின் அறிவு தெளிவடையாத குரானின் விளக்கங்களும் ஏராளம்
    குறிகிய மூளையின் தோன்றல்களில் நின்றுகொண்டு உலகை நம் கண்ணுக்குள் பார்க்கும் தூரம் போலவே நம்பிக்கையையும் கருதக்கூடாது.
    இன்னும் பார்த்திராத அனுபவித்திராத உலகின் ஏராளம் போலவே நம்பிக்கையின் வெளிப்பாடுகளும் அவை காட்டும் வெகுமதிகளும் ஏராளம் ஏராளம்.
    வெறுமனே எழுத்துக்கள் கொண்டு நம்பிக்கையின் தூரத்தை அளவை நிருத்துவிடமுடியாது.
    நேற்றைய நம் முன்தோன்றல்கள் அனுபவித்திராத அறிவியல் ஆதாரங்கள் ஆகமங்கள் போலவே நாம் அறிந்திராத அறிவியல்கள் நம் பின்தோன்றல்கள் அனுபவிக்கப்போகும் அறிவியல் ஆதாரங்கள் ஆகமங்கள் ஏராளம் ஏராளம். அவைகள் எல்லாம் உங்கள் கண்களுக்கும் கற்பனைகளுக்கும் எட்டுவதில்லை எட்டப்போவதுமில்லை.
    இது இதுபோலவே இறைவனின் படைப்புகள். அவனின் அற்ப்புதங்கள்.
    இது நம்பிக்கை சார்ந்த விஷயம்.
    நம்பினால் நம்புங்கள்.


    WASSALAM
    KADIR ALI
    0501268076

  6. நம் முன்தோன்றல்கள் அவர்கள் காலத்தில் காட்டில் வசித்தவர்கள் இன்றைய அறிவியல் கண்டு பிடிப்புகள் பற்றிய முன்னறிவிப்புகளை கூறும்போது எப்படி அவர்களின் மூளைக்கு அபத்தமாய் தெரியுமோ அதுபோலவே….
    அவ நம்பிக்கையாளர்களுக்கு இறைவனின் படைப்புகளும் அற்புதங்களும் அபத்தமாக தெரிவதில் ஐயமில்லை., ஆச்சரியமும் இல்லை.
    அன்றைய நம்முன்னோர்கள் நினைத்திருக்க மாட்டார்கள் நம்மைப்போலவே உண்டு நம்மைப்போலவே கழித்து விளித்து வாழும் நம் பின் சமூகம் இத்தகைய அறிவியல் உலகில் வாழ்வார்கள் என்று………….

    ஆனால் நாங்கள்(நம்பிக்கையாளர்கள்) முன்னறிவிப்பு செய்கின்றோம்

    அலலாஹ் (படைத்தவன்) உண்மை,
    அவன் படைத்தவைகள் உண்மை.
    அவனுடைய தூதர்கள் உண்மை,
    அவனுடைய வாக்குகள் உண்மை.
    அவனுடைய வேதங்கள் உண்மை
    குர் ஆன் உண்மை,
    சுவர்க்கம் உண்மை,
    நரகமும் உண்மை,

    நாம் வாழ்வதும் மரணிப்பதும் உண்மை போலவே
    நாம் மீண்டும் எழுப்பப்படுவதும் விசாரிக்கப்படுவதும்
    வினைகளுக்கு கூலி கொடுக்கப்படுவதும் என்று
    எல்லாமே உண்மைகள்….

    இதற்க்கு நானும் சாட்சி நாங்களும் சாட்சி நீயும்(நீங்கள்) சாட்சி, நீங்களும் சாட்சி.

  7. மேலே உள்ள எனது கருத்தில் ஒரு சிறிய திருத்தம்

    “பரிணாம கொள்கை அறிவியல் ( !!!!!!!!!!) பூர்வமானது என்று வாதிடும் நீங்கள் அந்த கொள்கையில் உள்ள ஓட்டை களை கண்டுகொள்ளாதது ஏன்?

  8. /படைப்பு கொள்கை நம்பிக்கை சார்ந்தது. அதில் அறிவியல் இல்லை./
    முதல் முறையாக் இப்படி உண்மை கூறும் ஒரு இஸ்லாமியரை சந்திக்கிறென்
    .இத்னை உங்க்ள் பிரச்சாரகர்கள் அனைவரும் ஒத்துக் கொண்டால் பிரசினை இல்லையே.பிர மதங்கள் எந்த அள்விற்கு நம்பிக்கை சார்ந்ததோ,அதே அள்வுதான் இஸ்லாமும்.
    இபடி இருக்க என் மதம் மட்டுமே சரி என்ற கருத்தை மாற்றிக் கொள்ளுங்கள்.

    ________

    /சகோ கள் ஆஷிக் அஹ்மத் , கார்பன் கூட்டாளி , குலாம் ஆகியோரின் பரிணாம கொள்கை பற்றிய நியாய மான கேள்விகளுக்கு சரியான பதில் எந்த பதிவரும் சொல்லவில்லை./
    அவைகள் அவர்களின் கேள்விகள் அல்ல.
    கிறித்தவ‌ படைப்புக் கொள்கையாள‌ர்களின் தளத்தில் இருந்து மொழி மாற்றம் செய்யப் பட்டவை.அந்த படைப்புக் கிறித்தவ கொள்கையளர்களின் கேள்விகளுக்கு ஏற்கெனவே பதில் அளிக்கப்பட்டு விட்டது.அந்த மொழி பெயர்ப்பாளர்களின் கேள்விகள் அவர்களது&அவர்கள் கருத்துகள் எடுத்த தளத்தின் தவறான புரிதலை மட்டுமே காட்டுகின்றன.

    இரு விஞ்ஞானிகள் சில விள்க்கங்க்ளில் வித்தியாசம் கொண்டால் அதனை மொழி பெயர்த்து எழுதுபவ்ர்கள்தான் உங்கள் சகோக்கள்.

    இஸ்லாமிய நாடுகளில் பரிணாமம் பள்ளி,கல்லூரிகளில் கற்பிக்கப் படுகிறதா? இல்லையா?
    __________
    இப்பதிவு குரானின் படைப்பு கொள்கை பற்றி இப்பதிவு பேசுகிறது.இது நம்பிக்கை மட்டுமே. நிருபிக்க முடியாது என்பதால் இப்படி கூறுகின்றீர்கள் என்பதும் தெரியும்.

    இப்பதிவில் சொன்ன அனைத்துமே நம்பிக்கை மட்டுமே சார்ந்தது.பரிணாமம் என்பது சான்றுகளை விளக்கும் அறிவியல் கொள்கை.
    __________
    /உங்களின் அறிவு தெளிவடையாத குரானின் விளக்கங்களும் ஏராளம்/

    எங்களை சொல்ல வேண்டாம்.பல்ருக்கு அறிவு தெளிவடையாததால்தான் இன்னும் குரான் விள்க்க தொழில் நன்றாக் நடக்கிறது.ஒரு வசனத்திற்கு பல் விள்க்கம் உண்டு என்ப்துதான் சிக்கல். காலம் மாற மாற குரானின் விளக்கமும் பரிணாம் வளர்ச்சி அடைவதே பரிணாம்த்தின் நிருபணம்.

    இபின் அப்பாஸ்,அல் சுயுட்டி,அல் தபரி,இபின் கதிர்,பித்கல்,யூசுஃப் அலி,ஜான் ட்ரஸ்ட்,பி.ஜே
    என்று ஒரு வசத்னத்தை எடுத்து விளக்க்ம பாருங்கள்.குரானின் விள்க்க பரிமாண வளர்ச்சி புரியும்!!!!!!!!!!.

  9. தோழர்,
    படிக்க சிரமமாக உள்ளது. எழுத்துருவை மாற்றுங்கள்

  10. “/பரிணாம கொள்கை அறிவியல் ( !!!!!!!!!!) பூர்வமானது என்று வாதிடும் நீங்கள் அந்த கொள்கையில் உள்ள ஓட்டை களை கண்டுகொள்ளாதது ஏன்?/

    பரிணாம் கொள்கை என்பது கிடைத்த படிம சான்றுகள்,காலக் கணக்கீடுகள் முதலிவற்றை விளக்கும் ஒரு கொள்கை.சான்றுகளுக்காகவே கொள்கையே தவிர ஒரு புத்தக்த்தில் எழுதியுள்ளது என்பதற்காக அத்னை எப்படியாவது பொயாயகாத வண்னம் மாற்றி மாற்றி விளக்கம் கொடுப்பதல்ல.

    இன்னொரு அறிவியல் கொள்கை வருகிறது என்றாலும் அதுவும் இந்த சான்றுகளை,கால்க் கணக்கீடுகளை பரிணாம்த்தை விட உறுதி செய்ய வேண்டும்.

    இந்த 100 வருடங்களில்பரிணாம் விளக்கங்களில் மட்டும் கொஞச‌ம் மாறுதல்கள் அதுவும் கிடைத்த சான்றுகளின் அடிப்படையிலேயே மாற்று கருத்து முன் வைக்கப் படுகிறது.

    பரிணாம்த்தை முற்றும் முழுதாக் மறுக்கும், மதவாதியல்லாத, ,மாற்றுக் கொளை முன் வைக்கும் அறிவியலாளர் சிலரை கூறவும்!!!!!!.

    இந்த ஓட்டைகள் என்று கூறுவது தவ்றான புரிதல்கள் மட்டுமே.இதே கேள்வியை மதவாதிகளிடமும் கேட்கலாம்.ஏன் பல வர்த்தைகளுக்கு புதிது புதிதாக் அர்த்தம் இப்போது கண்டுபிடித்து,அறிவியல் அன்றே கூறப்பட்டுள்ளது என்ற ஏமாற்று வேலை செய்து மதத்தை காப்பாற்ற முயல்கிறீர்கள்?

  11. நண்பர் ரப்பானி,

    இஸ்லாத்தின் படைப்புக்கொள்கை நம்பிக்கை சார்ந்தது மட்டுமே, அதில் அறிவியல் இல்லை என போட்டுடைத்ததற்கு நன்றி. மனிதர்களிடையே உயர்ந்தவன் தாழ்ந்தவன் எனும் பேதம் ஏற்படக்கூடாது என்றால், அதுகுறித்தான விழிப்புணர்வை மக்களுக்கு ஏற்படுத்த வேண்டும். அவ்வாறு பேதம் பிரிப்பது ஒட்டுமொத்த மனிதகுலத்திற்கு எவ்வாறு தீங்காக இருக்கிறது. பேதத்தினால் ஏற்படும் விளைவுகள், சமத்துவத்தினால் கிடைக்கும் வாய்ப்புகள் குறித்து மக்களை உணரச் செய்து அதை ஏற்று நடக்கும் நிலையை ஏற்படுத்த வேண்டும். கடவுள் பயங்காட்டி செய்யப்படுவது மெய்யான சமத்துவமாகவும் இருக்காது, மெய்யான பலனையும் தராது. ஏதோ ஒன்றை ஏற்படுத்த எதையோ ஒன்றைச் செய்யும் வித்தை விளையாட்டுகளையெல்லாம் மனிதன் கடந்து வெகு காலமாகிவிட்டது.

    பரிணாமக் கொள்கையில் என்ன ஓட்டை இருக்கிறது என்று கொஞ்சம் விளக்கினால் நன்றாக இருக்கும். அப்படி ஏதேனும் இருந்தால் அதை புறந்தள்ள அல்லது கண்டுகொள்ளாமல் விட நான் மதவாதியல்ல. நீங்கள் குறிப்பிட்டிருக்கும் மூவரில் ஆஷிக் அஹமது தெரியும் ஏற்கனவே ஒருமுறை செயற்கை செல் தொடர்பாக விவாதித்திருக்கிறோம். அவருடைய பரிணாமம் குறித்த பதிவுகள் பிரபலமானவை. அவைகளுக்கு மறுப்பெழுதும் திட்டம் இருக்கிறது, வாய்ப்பு கிடைக்கும் போது அவரது கட்டுரைகளுக்கு மறுப்பளிக்கிறேன். கார்பன் காப்பியின் சில பின்னூட்டங்களைக் கண்டிருக்கிறேன் (தருமி ஐயா தளத்தில் என்று நினைவு) அவர் தனியாக வலைதளம் வைத்திருப்பது தெரியாது. குலாம் குறித்து தெரியாது. இயன்றால் சுட்டி தாருங்கள் படித்துப் பார்க்கிறேன். இவைகளை மீறி அவசரம் என கருதினால் அந்த வலைதளங்களின் கேள்விகளை இங்கே நீங்கள் கேட்கலாம்.

  12. நண்பர் காதர் அலி,

    நான் அடிக்கடி இப்படி கூறுவது வழக்கம். “உங்கள் நம்பிக்கை என்று வந்துவிட்டால் அதில் கேள்வி எழுப்ப ஒன்றுமில்லை. ஆனால் அறிவியல்பூர்வமாக இதுதான் சரி, மற்றவைகளெல்லாம் தவறு எனும்போது அங்கு விவாதிப்பதற்கு அதிகமுண்டு“ இஸ்லாம் எப்படி பரப்புரை செய்யப்படுகிறது என்பது உங்களுக்கு நன்றாகவே தெரியும்.

    செங்கொடியின் மரணம் குறித்தான விமர்சனங்களும், இஸ்லாம் குறித்தான விமர்சனங்களும் ஒன்றல்ல. செங்கொடியின் தற்கொலையை விமர்சிப்பவர்கள் மதத்தின் மீது ஏறி நின்று கொண்டு அதைச் செய்கிறார்கள். அல்லது இரக்க உணர்ச்சியின் மீது ஏறி நின்றுகொண்டு அதைச் செய்கிறார்கள். ஆனால் செங்கொடியின் மரணம் அரசியல், சமூக விளைவு. அந்த இரண்டின் மீதும் ஏறி நிற்பவர்களால் இதை கண்டுகொள்ள முடிவதில்லை. அதேநேரம் இஸ்லாத்தின் மீதான விமர்சனம் அரசியல், சமூகத் தளத்திலிருந்து செய்யப்படுவது. அங்கு வெற்று நம்பிக்கைகளுக்கு இடமில்லை, சரியா தவறா என்பது மட்டுமே முதன்மைப்படுத்தப்படும். ஏனென்றால் செங்கொடியின் மரணம் சமுகத்தின் தாக்கத்தில் எடுக்கப்பட்டிருந்தாலும் தனிப்பட்ட முடிவு. இஸ்லாமோ தனிமனிதன் மீது தாக்கம் செலுத்தினாலும் சமூகத்திற்கானது. இந்தக் காரணிகளையெல்லாம் விலக்கிவிட்டு செங்கொடிக்கு இருந்ததும் நம்பிக்கை, எங்களிடம் இருப்பதும் நம்பிக்கை என்பீர்களாயின், அதில் நான் தலையிட ஒன்றுமில்லை.

    மனித அறிவு, அறிவியல் குறித்து நீங்கள் கூறியிருப்பது தோராயமாக சரிதான். அறிவியல் பல கேள்விகளுக்கு இன்னும் விடை தேடிக் கொண்டிருக்கிறது. ஆனால், (உங்கள் விருப்பப்படி) இன்னும் கண்டுபிடிக்கப்படாத ஒன்றை, என்றோ யாரோ சொன்னார்கள் என்று, அதுதான் சரி என நம்பி, மொத்த வாழ்க்கையையும் அந்த நம்புதலிடம் ஒப்புக் கொடுக்க முடியாதல்லவா? அதுவும் சமூக வரலாறுகளும், அறிவியல் ஆய்வுகளும் அந்த நம்புதலுக்கு எதிராக இருக்கும் போது. ஒருமுறை பெரியாரிடம் கேட்டார்களாம், “கடவுள் இல்லை என்று தீவிரமாக பிரச்சாரம் செய்கிறீர்களே, கடவுள் உங்கள் முன் நேரிலே தோன்றி தன்னை நிரூபித்து விட்டால் என்ன செய்வீர்கள்” என்று. பெரியார் சிரித்துக் கொண்டே கூறினாராம், “அன்றிலிருந்து கடவுள் இருக்கிறான் என்று பிரச்சாரம் செய்வேன்” என்று. அவ்வளவு தான்.

  13. /ஆஷிக் அஹமது தெரியும் ஏற்கனவே ஒருமுறை செயற்கை செல் தொடர்பாக விவாதித்திருக்கிறோம். அவருடைய பரிணாமம் குறித்த பதிவுகள் பிரபலமானவை. அவைகளுக்கு மறுப்பெழுதும் திட்டம் இருக்கிறது, வாய்ப்பு கிடைக்கும் போது அவரது கட்டுரைகளுக்கு மறுப்பளிக்கிறேன்/

    நண்பர் ஆஸிக் அகமதின் பதிவுகளை மிகவும் சிலாகித்து சில நண்பர்கள் புகழ்வதல் அவர் என்ன பதிவுகளில் கூறியுள்ளார் என்பத்னை பார்க்க போகிறோம்.

    இவருடைய இந்த பதிவை எடுத்துக் கொள்வோம்.
    Evolution St(he)ory > Harry Potter Stories – II

    http://www.ethirkkural.com/2010/05/evolution-stheory-harry-potter-stories_29.html

    என்ன கூறுகிறார்?

    //1. பரிணாமத்தின் மிகப் பெரிய ஆதரவாளரான Talk Origins தளத்தின் படி, “பரிணாமம் என்றால் என்ன”வென்று ஆக்ஸ்போர்ட் அறிவியல் அகராதி (Oxford Concise Science Dictionary) சொல்லுகிறதென்றால், //

    பரிணாம்த்தின் மிகப் பெரிய ஆதர்வு தளம் Talk Origins.org!!!!!!!!!!!!
    Joke of the century!!!!!!!!!!!!

    இது தவறு. இது கிறித்தவ படைப்புக் கொள்கையாளர்களால் நடுநிலையான தளம் போன்ற முகமூடியுடன் நட்த்தப் படுகின்றது.
    http://en.wikipedia.org/wiki/TalkOrigins_Archive

    The TalkOrigins Archive is a website that presents mainstream science perspectives on the antievolution claims of young-earth, old-earth, and “intelligent design” creationists. With sections on evolution, creationism, and hominid evolution, the web site provides broad coverage of evolutionary biology and the socio-political antievolution movement.

    http://www.talkorigins.org/foundation/

    a. Wesley Elsberry, President
    http://en.wikipedia.org/wiki/Wesley_R._Elsberry
    b. John Wilkins, Vice-President
    http://www.talkorigins.org/faqs/evolphil/falsify.html
    c. Kenneth Fair, Secretary and Treasurer

    இது எப்படி இருக்கிறது என்றால் தமிழ் இந்து தள‌த்தின் இஸ்லாம் பற்றிய கட்டுரை இஸ்லாமுக்கு ஆதரவான‌து என்று கூறுவது போன்றது.

    http://www.talkorigins.org/faqs/evolution-definition.html

    இந்த கட்டுரையின் தமிழ் மொழியாக்கமே இப்பதிவு.இதில் என்ன கூறுகிறார்கள் பொருள் அகராதிகளில் உள்ள பரிணாம் வரையறுப்பு வித்தியாசமாக் உள்ளது என்று காட்டுகிறார்கள்.
    இதில் ஆஸிக் ஒரு படி மேலே போய் இந்த டாக் ஆர்ஜின் தளத்தில் வரையறுப்பும்,இதர அகராதிகளின் வரையறுப்பும் வித்தியாசப் படுகின்ரது என்று ஒப்பிடுகிறார்.ஆக்வே பரிணாம் வரையறுப்பே குழப்பம் என்கிறார்.

    //உங்களில் பலர், ஆக்ஸ்போர்ட் அறிவியல் அகராதி சரியாகத் தானே கூறுகிறது என்று நினைக்கலாம். அங்குதான் பிரச்சனையே…

    Talk Origins தளம் என்ன தெரியுமா கூறுகிறது? ஒரு அறிவியல் அகராதி இப்படி விளக்கியிருப்பது மன்னிக்க முடியாததாம்.

    “This is inexcusable for a dictionary of science” – Talk Origins//

    இப்பதிவுக்கு என்ன மறுப்பு சொல்வது நாங்கள் கூறுகிறோம்
    இந்த தளம் பற்றி ஆஸிக் கூறியது தவறு.அதனோடு மற்ற அகராதிகளை ஒப்பிட அவருக்கு நேரம் இருப்பின் பொழுது போக்கலாம்.

    அவருடைய ஒவ்வொரு பதிவுமே இப்படித்தான்,இதற்கு போய் பதில் சொல்வதா என்றே பெரிய அறிவியல் பதிவர்கள் கண்டு கொள்வதில்லை.
    ஆக்வே அந்த பதிவே ஒரு நகைசுவை பதிவு!!!!!!!!!.

    இதற்கு யாரேனும் மறுப்பு தெரிவிக்க்லாம்!!!!!!!!!

  14. சகோதரர் சார்வாகன்,
    அஸ்ஸலாமு அலைக்கும்,

    ஏங்க என்னுடைய நேரத்தை வீனாக்குறீங்க….உங்ககிட்ட ஏதாவது கேட்டா அத அங்கேய வச்சுக்குங்க சகோதரர். எதுக்கு இங்கே வந்து அத பேஸ்ட் பண்ணுறீங்க…

    சரி வந்தது வந்துடீங்க..கேட்டுட்டு போங்க…

    talkorigins ஒரு die-hard evolutionist site. எனக்கு தெரிந்து இதுல யாருக்குமே இதுவரை குழப்பம் வந்தது கிடையாது. ஆனா நீங்க என்ன சொல்றீங்க,

    ///இது தவறு. இது கிறித்தவ படைப்புக் கொள்கையாளர்களால் நடுநிலையான தளம் போன்ற முகமூடியுடன் நட்த்தப் படுகின்றது.///

    what a crap…. இதுக்கு என்ன ஆதாரம்??

    நீங்க இப்படி சொன்னதுக்கு பரிணாம ஆதரவாளர்கள் உங்களை கோபித்து கொள்ளாமல் இருந்தால் சரி.

    நீங்க கொடுத்த விக்கிபீடியா லிங்க்க படிச்சீங்களா இல்லையா..அதுல எங்கேயுமே நீங்க மேல சொன்ன மாதிரி சொல்லப்படல. ஆனா அது என்ன சொல்லுதுன்னா…

    ////Talkorigins.org has gained many awards and achieved substantial recognition.[3]
    In August 2002 Scientific American recognized Talkorigins.org for its “detailed discussions (some of which may be too sophisticated for casual readers) and bibliographies relating to virtually any objection to evolution that creationists might raise.”[4]
    The webpages of the National Academy of Science, Smithsonian Institution,[5] Leakey Foundation,[6] the National Center for Science Education[7] and other organizations recommend Talkorigins.org.
    Biomednet gave the Archive four stars.[specify]
    The Archive is also referenced in college-level textbooks[8] and has had material from the archive incorporated into over 20 college or university courses//////////////////////

    இந்த தளம், கிறித்தவ படைப்புக் கொள்கையாளர்களால் நடத்தப்பட்டால் ஏன் சகோதரர் Scientific American, NAS, NCSE போன்ற பரிணாம ஜாம்பவான்கள் இந்த தளத்த recommend பண்ண போறாங்க???

    =======
    கொஞ்சம் இணையத்தில் எழுதும் போது பல்முறை யோசித்து சரி பார்த்து எழுதவும்
    =====

    உங்கள நோக்கி சொல்லி கொள்கின்றீர்களா?

    ======
    ஆக்வே குரான் 2.42ஐ உண்மையாக் பின்பற்ற வேண்டுகிறேன்!!!!!!!!!!
    ======

    சரியாதானே பின்பற்றுகின்றோம்..இதில் என்ன குழப்பம். வேணும்னா, என்னோட பரிணாம பதிவுகள் அனைத்தையும் படித்துவிட்டு, அதுல உள்ள reference-களை பார்த்துவிட்டு நான் பொய் சொல்றேன் என்று நிரூபியுங்கலேன் பார்ப்போம்.

    இப்ப கூட பாருங்க. நீங்க தான் பொய்ய கொண்டு வந்து தெளித்துவிட்டு போயிருக்கீங்க..

    அதெல்லாம் சரி, நீங்க இங்கே போட்ட கமெண்ட்ட எங்கே போய் உளறி கொட்டிநீங்க..இருங்க நானே தேடி கண்டுபிடித்து வரேன்…

    மேலே சொன்னத திருப்பி சொல்றேன். உங்க கிட்ட கேட்டா உங்களோட நிறுத்துங்க. இங்கே வந்து பேஸ்ட் பண்ணி என்னோட நேரத்த வீனாக்காதிங்க. ப்ளீஸ்..

    உங்களோட உளறலுக்கு பதில் சொல்ற அளவுக்கு எனக்கு நேரம் இல்ல.

    புரிந்துகொள்வீர்கள் என்று நம்புகின்றேன்…

    உங்களுக்கு இறைவன் நேர்வழி காட்ட பிரார்த்திக்கும்,

    உங்கள் சகோதரன்,
    ஆஷிக் அஹமத் அ

  15. //நீங்க கொடுத்த விக்கிபீடியா லிங்க்க படிச்சீங்களா இல்லையா..அதுல எங்கேயுமே நீங்க மேல சொன்ன மாதிரி சொல்லப்படல. ஆனா அது என்ன சொல்லுதுன்னா//…/

    இதுதான் லின்க்

    http://en.wikipedia.org/wiki/TalkOrigins_Archive
    இது முதல் வரி

    TalkOrigins Archive
    From Wikipedia, the free encyclopedia
    The TalkOrigins Archive is a website that presents mainstream science perspectives on the antievolution claims of young-earth, old-earth, and “intelligent design” creationists. With sections on evolution, creationism, and hominid evolution, the web site provides broad coverage of evolutionary biology and the socio-political antievolution movement.

    அதனை நடத்துபவர்கள் அனைவருமே பரிணாம‌ எதிர்ப்பாளர்கள்.அவர்களின் கருத்தாக நீங்கள் கூறுவதில் எனக்கு ஆட்சேபனை இல்லை.டாக் ஆர்ஜின் என்பது பரிணாம் ஆதரவு தளம் என்பது நீங்கள் குறிப்பிட்டது தவ்று.

    இன்டெலிஜன்ட் டிசைன் எனப்படும் கொள்கை பற்றி ஆதரவு தெரிவிக்கிறார்கள்.பாருங்கள்.

    http://www.talkorigins.org/indexcc/

    பரிணாம் ஆதரவு தளத்தில் பைபிளின் ஆதியாகமம் இருக்கிரது பாருங்கள்.

    http://www.talkorigins.org/faqs/genesis.html

    001:001 In the beginning God created the heaven and the earth.

    ….பரிணாம் தளத்தில் பைபிளா!!!!!!!!!!!!!!!!!!
    _____________
    எனக்கு நன்றாக் தெரியும் டாக் ஆர்ஜின் என்பது பரிணாம் எதிர்ப்பு தளம்.அத்னை ஆதரவு தளம் என்று கூறுவது தவறு.

    தவறு அனைவருக்கும் இயல்பே.இந்த இணைப்புகளை பார்க்கும் நண்பர்கள் முடிவு செய்யட்டும்.இங்கு உங்கள் சகோக்கள் உங்களை பற்றி கூறியதால்தான் சரிபார்க்க வேண்டியது ஆயிற்று.முக்கியமான் விவாதங்களில் இது தவிர்க்க இயலாது.

  16. Wesley R. Elsberry
    http://en.wikipedia.org/wiki/Wesley_R._Elsberry
    இவர்தான் இப்போதைய டாக் ஆர்ஜின் தளத்தின் தலைவர்.இவரின் இன்னொரு தளம் Antievolution.org

    In 2003, he took the position of Information Project Director at NCSE

    இப்போது எப்படி NCSE இத்தளத்தை பரிந்துரை செய்கிறர்கள் என்று தெரியுமே!!!!!!!
    _____________
    In 1986, Elsberry attended a lecture by a Young-Earth Creationist geologist. Following that, he took up criticizing antievolution claims in letters to the editor of newspapers and in online fora. His stance in these matters has been one of theistic evolution, with the concern that science be taught in science classes, and non-science be taught elsewhere. He participated in Fidonet echoes, particularly the Science Echo, from 1988 to 1994. In 1989, he began operating his own BBS, first as an RBBS-Net node and later as a Fidonet node. He started the Neural-Net Echo in 1989, and the Evolution Echo in 1991. He became a participant in the Usenet talk.origins newsgroup in 1991. By 1995, he had contributed a FAQ on punctuated equilibria to the TalkOrigins Archive, as well as the Jargon and Biographica compilations. He also created his own set of web pages dealing with scientific creationism in 1995.[citation needed]
    In 1997, he presented at the “Naturalism, Theism, and the Scientific Enterprise” conference held by intelligent design advocates in Austin, Texas, giving a defense of methodological naturalism. He also assisted the National Center for Science Education that year with regard to the review of science textbooks undertaken by the state of Texas.[citation needed]
    In 2001, he presented opposite William A. Dembski at the Center for Theology and the Natural Sciences/American Association for the Advancement of Science “Interpreting Evolution” conference at Haverford College, Haverford, Pennsylvania. Brett Vickers turned over care and maintenance of the TalkOrigins Archive to him late in 2001. He established a group of about a dozen volunteers, the TalkOrigins Archive Delegation, to handle needed maintenance and updates of the site. He also established the Antievolution.org site in 2001 as a place to collect critical information on the antievolution movement. In 2002, he presented at the “Evolution and Intelligent Design” session of the CSICOP 4th World Skeptics conference in Burbank, California, along with Massimo Pigliucci, Kenneth Miller, Paul Nelson, and William A. Dembski.[citation needed]
    In 2003, he took the position of Information Project Director at NCSE.[citation needed]
    In 2004, he helped establish the Panda’s Thumb weblog. While hospitalized following emergency surgery resulting from chronic ulcerative colitis, he established his personal weblog, The Austringer.[citation needed]
    _____________
    வேண்டுமானால் டாக் ஆர்ஜின் தளம் பரிணாம் படைப்பு கொள்கை இரண்டையும் ஆய்வு செய்வதாக் கூறும் ஒரு தளம் என்று கூறுவதில் ஆட்சேப்னை இல்லை.
    பரிணாம்த்திற்கு மட்டுமே மிக ஆதரவான தளம் என்பது தவறு

  17. கடவுள் இல்லை அல்லா தான் இருக்கிறான் அல்லா என்றால் அறிவியல் தான். அறிவியலை நம்பியவன் ஒரு போதும் கடவுளை நம்பி மோசம் போகமாட்டன் அரபில் -அல்லா தமிழில்-அறிவியல் ஆங்கிலத்தில்-சயின்ஸ்

  18. கடுவுளை அறிவியல் தான் என்று நம்பினால் எந்த சண்டையும் மக்களிடத்தில் வராது இந்த உலகத்தில் எந்த ஒரு கடவுல்லாலும் எதையும் கொடுக்க முடியாது ஆனால் அறிவியலை ஆராய்ந்தால் முடியாதது எதுவும் இல்லை அல்லாஹு அக்பர் (அறிவியல் மிக பெரியது )

  19. சகோதரர் சார்வர்கன்,

    அஸ்ஸலாமு அலைக்கும்,

    திரும்பவும் சொல்கின்றேன் உளறி கொட்டாதீர்கள்…

    talkorigins என்பது பக்கா பரிணாம ஆதரவு தளம். படைப்புவாதிகளின் கருத்துக்களுக்கு பதில் அளிப்பதை முதன்மையாக கொண்ட தளம். அதைத்தான் விக்கிபீடியாவின் அந்த தளம் குறித்த முதல் வாக்கியங்கள் கூறுகின்றன..

    சரி உங்கள் வழிக்கே வருகின்றேன்…

    ////TalkOrigins Archive
    From Wikipedia, the free encyclopedia
    The TalkOrigins Archive is a website that presents mainstream science perspectives on the antievolution claims of young-earth, old-earth, and “intelligent design” creationists. With sections on evolution, creationism, and hominid evolution, the web site provides broad coverage of evolutionary biology and the socio-political antievolution movement.////

    இதனை தமிழில் மொழிபெயர்த்து சொல்லுங்கள்.

    அப்புறம் ///The Archive is also referenced in college-level textbooks[8] and has had material from the archive incorporated into over 20 college or university courses/// – இதையெல்லாம் படிக்க மாட்டீர்களா??..

    சரி, உங்களுக்கும் வேண்டாம், எனக்கும் வேண்டாம். கடுமையான பரிணாம ஆதரவாளர்களான கையேடு ரஞ்சித், தருமி, சகோதரி அனலிஸ்ட் போன்றவர்களிடம் talkorigins பற்றி கேட்டு விட்டு வாருங்கள்…

    உங்களிடம் நேரத்தை வீணாக்க இனியும் நான் விரும்பவில்லை.

    உங்கள் சகோதரன்,
    ஆஷிக் அஹமத் அ

  20. நண்பர் ஆஸிக் அகமது,
    1.முதலில் இந்த தளம் பற்றி அவர்களே என்ன கூறுகிறார்கள்?

    இது ஒரு Usenet newsgroup.பலரின் கருத்து பகிரும் தளம் என்று மொழி பெயர்க்கலாம். பரிணாமம் படைபியல் என்பதை controversy என்றே அனுகுகிறார்கள். .

    http://www.talkorigins.org/

    Talk.origins is a Usenet newsgroup devoted to the discussion and debate of biological and physical origins. Most discussions in the newsgroup center on the creation/evolution controversy, but other topics of discussion include the origin of life, geology, biology, catastrophism, cosmology and theology.

    The TalkOrigins Archive is a collection of articles and essays, most of which have appeared in talk.origins at one time or another. The primary reason for this archive’s existence is to provide mainstream scientific responses to the many frequently asked questions (FAQs) that appear in the talk.origins newsgroup and the frequently rebutted assertions of those advocating intelligent design or other creationist pseudosciences.

    2. இந்த தளத்தில் பல படைபியல்வாதிகளின் கட்டுரைகளும் இடம் பெற்று இருக்கிறது
    Evolution and the Qur’an
    Post of the Month: November 1996
    Ali Arshad
    http://www.talkorigins.org/origins/postmonth/nov96.html

    3.உங்களுடைய பல் பதிவுகள் இம்மாதிரி கருத்துளை கொண்டவைதான்.நீங்கள் சுயமாக் எழுதும் பரிணாம் விமர்சன‌ கட்டுரை கூட வெளியிட முடியும்.
    பல பரிணாம் மறுப்பாளர்களுக்கு இத்தளத்தில் உள்ள தகவல்களே பல விதங்களில் உதவியாக் இருக்கிறது.

    4.இத்தளத்தில் உள்ள விவரங்கள் அனைத்தும் சோதிக்கப் படாமல் அனுமதிக்கப் பட்டவை[content is unfiltered] என்றும் கூறுகிறார்கள்

    http://www.talkorigins.org/origins/feedback/

    Talk.Origins on UseNet includes many knowledgeable professionals. However, since content is unfiltered, posters interested in discussing facts are advised to ignore rude and inappropriate comments that may be made by others. (Uninformed comments that might appear authoritative are almost always corrected.)

    Since the above access to Talk.Origins is through Google Groups you may need to open a Google account to post your questions or comments.
    Because the content of posts fed to Talk.Origins via UseNet is uncontrolled, comments of a hateful, obscene, racist or other character which are inappropriate for young people do appear.
    ____________
    5.நீங்கள் எழுதிய பல பதிவுகளில் இத்தளத்தின் கட்டுரைகளை சுட்டி அதுவே பரிணாம் அறிவியலாளர்களின் கருத்தாக காட்ட முயல்வது தவறு.இது ஒரு கருத்து பகிரும் தளம் மட்டுமே .இதில் பரிணாம்ம் ,படைப்பியல் இரு கொள்கைகளை பற்றியும் அறிவியலொடு மட்டும் எழுதலாம்.

    What is talk.origins?

    Talk.origins (“t.o.”) is a newsgroup devoted to the discussion of issues related to biological and physical origins. Topics discussed include, but are not limited to, evolution, creation, abiogenesis, catastrophism, cosmology, and theology. Be assured that you will find lively, often heated, exchanges between people of all persuasions.

    Much of the bandwidth of t.o. is used for discussion of the merits of various ideas about origins. Other types of posts, however, are welcome (and, in fact, refreshing!), particularly [MI]:
    A scientific Theory of Creation
    Personal experiences which have affected your attitudes on the subject
    Relevant news, scientific and/or political
    Anything original, entertaining, and/or downright brilliant 🙂

    http://www.talkorigins.org/faqs/faq-welcome.html
    ________
    A scientific Theory of Creation
    என்று ஏற்பவர் பரிணாம் ஆதரவாளரா?

  21. நண்பர் செங்கொடி
    ” ஒவ்வொரு வினைக்கும் அதற்கு சமமான எதிர் வினை யுண்டு” என்பது நியூட்டன் 3 விதி

    மறுமையை நம்பும் ஒரு நம்பிக்கையாளனின் நம்பிக்கையின் படி நல்லவனுக்கு அவன் செய்த நன்மைகளுக்கு( வினை ) ஏற்றவாறு வெகுமதி ( சமமான எதிர் வினை) இவ் உலகில் கிடைக்காவிட்டாலும் மறு உலகில் கண்டிப்பாக கிடைக்கும்.அது போல் தீயவனுக்கு அவன் செய்த பாவங்களுக்கு சமமான தண்டனை இவ் உலகில் கிடைக்காவிட்டாலும் மறு உலகில் கண்டிப்பாக கிடைக்கும்.
    உங்களைப்போல் இறை மறுப்பாளர்களின் நம்பிக்கை யின் படி இவ் உலகில் நல்லவர்களாக வாழ்வது அறிவு பூர்வமானது அல்ல ஏனெனில் நல்லவர்களின் நல்ல செயல் களுக்கு சமமான வெகுமதி யும் தீயவர்களின் தீய செயல் களுக்கு சமமான தண்டனையும் இவ் உலகில் கிடைப்பது இல்லை.
    தர்க ரீதியில் மறுமை நம்பிக்கையோடு நல்லவனாக வாழ்வதில் தான் ஓர் அர்த்தம் உள்ளது. இறைமறுப்பாளன் நல்லவனாக வாழ்வதில் எந்த பயனும் இல்லை.
    ஒருவன் நல்லவனாக வாழ இறை நம்பிக்கை யும் மறுமை நம்பிக்கை யும் இன்றியமையாதது.

  22. கடுமையான பரிணாம் ஆதரவாளர்கள் என்றால் யார்?

    எனக்குத் தெரிந்து அப்ப்டி யாருமே இருக்க முடியாது.பரிணாமம் என்பது கிடைத்த படிமங்கள்,காலக் கணக்கீடுகள் அகியவற்றின் அடிப்படையில் உயிர்களின் தோற்றத்தை விள்க்கும் இப்போதைய அறிவியல் கொள்கை.

    ஒரு வேளை மனிதன் உட்பட அனைத்து உயிர்களின் வளர்ச்சி பெற்ற படிமங்கள் அனைத்தும் ஒரு இடத்தில் ஒரே கால அளவில் கிடைத்தால் பரிணாம் கொள்கை முற்றும் முழுதாக தவறாகி விடும். இதுவரை இப்படி கிடைக்கவில்லை.

    சில சான்றுகளின் அடிப்படையில் பரிணாம்த்தின் விளக்கங்கள் மாறுவதும் ஏற்புடையதே.பரிணாம் மரத்தில் கிளைகளில் அவ்வப்போது ஏற்படுத்தப் படும் மாற்றம் இத்தகையதே.சான்றுகளின் அடிப்படையில் மாறும் விளக்கங்களை ஏற்பவனே அறிவுள்ள மனிதன்.

    இது முழுக்க முழுக்க அறிவியலாளர்கள் மட்டும் ஆய்வு செய்யும் ஒரு விஷயம்.அவர்கள் ஏற்றுக் கொண்ட கருத்துகள் இப்போது கல்வியிலும் கற்றுத் தரப் படுகிறது.

    ஆகவே கடுமையான் பரிணாம் ஆதரவாளர்கள் என்று யாரும் இருக்க முடியாது.சான்றுகள் சொல்வதை ஏற்றுக் கொண்டு போக வேண்டியதுதான்!!!

    ஆனால் மதத்தின் காலத்திற்கு ஒவ்வாத நடைமுறை சட்டங்களை எதிர்க்கும் கடுமையான மத மறுப்பாளர்கள் உண்டு.

  23. சலாம் சார்வாகன்,

    அடப்போங்கப்பா…

    திரும்ப திரும்ப சொல்றேன் உளறிக்கொட்டாதிங்க (இந்த பின்னூட்டத்த தாண்டி இனியும் என் நேரத்த இங்கே நான் வீணாக்க போறதில்ல)…

    talkorigins தளம் கிறித்துவ படைப்புவாதிகளால் நடத்தப்படும் தளம்னு சொன்னீங்க…ஆதாரம் கேட்டேன். இன்னும் தரல..- அடப்போங்கப்பா

    அடுத்து talkorigins தளம் குறித்து நீங்க கொடுத்த விக்கிபீடியா லிங்க்ல சொன்ன தகவல மொழிபெயர்த்து தர சொன்னேன். அதையும் தரல…- அடப்போங்கப்பா

    இப்ப talkorigins தளம் குறித்த அடுத்த விசயத்துக்கு போயாச்சு – அடப்போங்கப்பா

    முதல்ல போய் talkorigins archive என்பதற்கும், talk.origins என்பதற்கும் என்ன வித்தியாசம்னு தெரிஞ்சுட்டு வாங்க (முதல் பக்கத்துலேயே தெளிவா சொல்லிருக்காங்க). நீங்க அறியாமைல உளருரதுக்கு எல்லாம் என்னால் பதில் சொல்லிட்டு இருக்க முடியாது.

    Talkorigins.org என்றால் Talkorigins archive பற்றி பேசுராங்கன்னு அர்த்தம்.

    talkorigins தளம் குறித்த விக்கிபீடியா லிங்க்ல சொல்றாங்க,

    ////The TalkOrigins Archive is a website that presents mainstream science perspectives on the antievolution claims of young-earth, old-earth, and “intelligent design” creationists./// – படைப்புவாதிகளின் பரிணாமத்திற்கு எதிரான வாதங்களுக்கு அறிவியல் ரீதியான விளக்கம் கொடுக்குற தளமாம் talkorigins archive….(உங்கள மொழிபெயர்க்க சொன்னேன். நீங்க செய்யல. இப்ப நானே பண்ணிட்டேன்). நானா சொல்றேன்..விக்கி தான் சொல்லுது – அடப்போங்கப்பா

    ////In August 2002 Scientific American recognized Talkorigins.org for its “detailed discussions (some of which may be too sophisticated for casual readers) and bibliographies relating to virtually any objection to evolution that creationists might raise.”//// — உலக பிரசித்திபெற்ற ஆய்விதலான scientific american முட்டாள்தனமா நடந்துகிட்டாங்க…talkorigins பத்தி தெரியாம, கிறித்துவ படைப்புவாதிகளால் நடத்தப்படும் talkorigins தளத்த recognise பண்ணுறாங்க…அப்படித்தானே – அடப்போங்கப்பா

    ///The webpages of the National Academy of Science, Smithsonian Institution,[5] Leakey Foundation,[6] the National Center for Science Education[7] and other organizations recommend Talkorigins.org.//// – NAS போன்ற பரிணாம ஜான்பவான்கள் talkorigins பத்தி தெரியாம, கிறித்துவ படைப்புவாதிகளால் நடத்தப்படும் talkorigins தளத்த பரிந்துரைக்குறாங்க…அப்படித்தானே – அடப்போங்கப்பா

    NCSE பத்தி விக்கி இப்படி சொல்லுது – ///It is the United States’ leading anti-creationist organization,[1] and defends the teaching of evolutionary biology and opposes the teaching of religious views in science classes in America’s public schools.//// – அதாவது, NCSE, அமெரிக்காவின் முன்னணி படைப்புவாத எதிர்ப்பு நிருவனமாம். பள்ளிகளில், அறிவியல் வகுப்புகளில் மதம் சார்ந்த பார்வைகள் நடத்தப்படுவதை எதிர்க்கும் நிருவனமாம். இவங்க எதுக்கு, கிறித்துவ படைப்புவாதிகளால் நடத்தப்படும் talkorigins தளத்த பரிந்துரைக்குறாங்க??? – அடப்போங்கப்பா

    ///The Archive is also referenced in college-level textbooks[8] and has had material from the archive incorporated into over 20 college or university courses//// — இந்த நிறுவனங்கள் எல்லாம் talkorigins பத்தி தெரியாம, கிறித்துவ படைப்புவாதிகளால் நடத்தப்படும் talkorigins தளத்த தங்களோட பாடப்புத்தகங்களில் reference காட்டுறாங்க, கோர்ஸ்களில் சேர்த்திருக்காங்க..அப்படித்தானே – அடப்போங்கப்பா

    எனக்கு தெரிந்து இது வரைக்கும் talkorigins தளத்தின் பரிணாம விசுவாசத்தை பரிணாம ஆதரவாளர்கள் கேள்வி கேட்டதா தெரியவில்லை…

    உங்களால் முடிந்தால் பரிணாமத்திற்கு எதிரான ஒரே ஒரு கட்டுரையை talkorigins தளத்தில் இருந்து காட்டுங்களேன் பாப்போம்…

    அடப்போங்கப்பா..நீங்களும் உங்க நம்பிக்கையும்….

    நன்றி,

    உங்கள் சகோதரன்,
    ஆஷிக் அஹமத் அ

  24. The five propositions below seem to be the most common misconceptions based on a Creationist straw-man version of evolution.

    i. Evolution has never been observed.
    ii. Evolution violates the 2nd law of thermodynamics.
    iii. There are no transitional fossils.
    iiii.The theory of evolution says that life originated, and evolution proceeds, by random chance.
    v. Evolution is only a theory; it hasn’t been proved.

    quranist@aol.com

  25. @ asik ahamed

    1.இது ஒரு Usenet newsgroup.பலரின் கருத்து பகிரும் தளம் என்று மொழி பெயர்க்கலாம்.
    சொல்லுங்கள் ஆம்/இல்லை

    2./talkorigins தளம் கிறித்துவ படைப்புவாதிகளால் நடத்தப்படும் தளம்னு சொன்னீங்க…ஆதாரம் கேட்டேன். இன்னும் தரல..- அடப்போங்கப்பா/
    அதன் தலைவர்கள் பற்றிய சுட்டிகள் அளித்தேன் படித்துப் பாருங்கள்.`

    3./உங்களால் முடிந்தால் பரிணாமத்திற்கு எதிரான ஒரே ஒரு கட்டுரையை talkorigins தளத்தில் இருந்து காட்டுங்களேன் பாப்போம்…/
    இந்த கட்டுரை பரிணம்த்தை எதிர்க்கிறதா? கொஞ்சம் லேடஸ்ட் ஆக கொடுக்க வேண்டும் என்றே மார்ச் 2011 கொடுக்கிறேன்.
    A)
    The Bible predicts what we should see in the Fossil Record
    Post of the Month: March 2011
    by Randy Crum
    http://www.talkorigins.org/origins/postmonth/2011_03.html
    _______
    B)
    http://www.talkorigins.org/indexcc/CC/CC300.html
    Complex life forms appear suddenly in the Cambrian explosion, with no ancestral fossils.
    Source:

    Morris, Henry M. 1985. Scientific Creationism. Green Forest, AR: Master Books, pp. 80-81.
    Watchtower Bible and Tract Society. 1985. Life–How Did It Get Here? Brooklyn, NY, pp. 60-62.
    ___________

    4.மேலே கண்ட இரு கட்டுரைகளும் பரிணாமத்தை ஆதரிக்கிறது என்று கூறுவீர்களா?
    பரிணாம் ,படைப்பியல் பற்றி அறிவியல் கோட்பாடுகளை மட்டும் வைத்து பற்றி யார் என்ன எழுதினாலும் அதனை சரிபார்க்காது வெளியிடும் கருத்து பரிமாறும் தளம். இந்த கேம்பிரிட்ஜ் என்ஸ்ப்ளொஸன் பற்ரிய கட்டுரை ஒரு படைப்பியல் கருத்தை வழி மொழிகிறதா இல்லையா?
    /There are transitional fossils within the Cambrian explosion fossils./

    இது கேம்பிரிட்ஜ் எக்ஸ்ப்ளோசனை பரிணாம கொள்கையாளர்கள் விளக்குகிறார்கள்.

    http://www.fossilmuseum.net/Paleobiology/CambrianExplosion.htm
    டாக் ஆர்ஜினில் பரிணாம விமர்சன கட்டுரை காண்பித்தாயிற்று.

  26. நண்பர் ரப்பானி,

    நியூட்டனின் விதியையும், உங்களின் நம்பிக்கையையும் கலந்து ஊறுகாய் செய்ய முயன்றிருக்கிறீர்கள். நம்பிக்கையாளனோ இல்லையோ உலகில் எந்த வினைக்கு எதிர்வினை நடக்கவில்லை என்கிறீர்கள்? எல்லா வினையிலும் அதன் எதிர்வினையும் இணைந்தே செயல்பட்டுக் கொண்டிருக்கிறது. நியூட்டனின் விதியை இன்னும் கொஞ்சம் அறிந்தால் அதை நம்பிக்கையில் ஊறப்போட முடியாது என்பது உங்களுக்கு தெரியவரும்.

  27. நான் சொல்ல வருவது என்ன வென்றால் இந்த தளத்தில் உள்ள பல கட்டுரைகள்
    பரிணாம்ம்,படைப்பியல்,மதம் என்று பல விஷயங்களை பற்றி எவர் வேண்டுமானாலும் பதிவிடலாம்.

    இது படைபியல்வாதிகளின் செயல்களை தொகுத்து அளிப்பது அவ்ர்களுக்கு செய்யும் மிகப் பெரிய தொண்டு ஆகும்.

    http://www.talkorigins.org/indexcc/list.html#CB0

    இந்த தளத்தில் கூறப்ப்டுவதை வைத்து மட்டும் பதிவிடுவது தவறு.உங்கள் தளத்திலுள்ள் அனைத்து கட்டுரைகளுமே இத்தளத்தில் உள்ள படைப்பியல் கொள்கைகள் சார்ந்த(கொஞ்சம் திரித்த) கட்டுரை என்று எளிதாக் கூறலாம்.talk orgin.org படைப்பியலின் மீது விமர்சனம் வைத்தாலும் கேம்பிரிட்ஜ் எக்ஸ்ப்ளோஸன் போன்ற சிக்லான விஷயங்களில் பரிணம்த்தை விமர்சிப்பது க்ண்கூடு.

    யார் வேண்டுமானாலும் எழுத முடியும்,பதிவிட முடியும் என்னும் போது இந்த தளம் பற்றி என்ன கூற முடியும்?.It is just an Usenet newsgroup.
    __________________

    உங்களின் பதிவுகள் பற்றி பேசலாம் என நினைக்கிறேன்.

    பல் அகராதிகளில் பரிணாமம் பற்றி கொஞ்சம் வித்தியாசமாக் இருப்பது பற்றிய பதிவில் டாக் ஆர்ஜின் சொலவது என்று கூறியதால் தான் அது பற்றி விவாதிக்க வேண்டியதாயிற்று.பல் அகராதிகளில் பல வித்தியாசமான் அர்த்தம் இருப்பதை பரிணாமம் பற்றியே குழப்பம் என்று காட்டுவது சரியா?

  28. @ஆஸிக் அகமது
    உங்கள் பதிவில் உள்ள பரிணாம் குறித்த விவாதிக்க தகுந்த கட்டுரைகலை மட்டும் எடுத்துள்ளேன். இவை அனித்துமே டாக் ஆர்ஜின் ட்தளத்தின் படைபியல் விள்க்கங்களில் இருந்தே எடுக்கப் பட்டது என்று காட்டினால் டாக் ஆர்ஜின் தளம் எப்ப்டி ப்யன்படுட்தப் படுகிற‌து என்பது புரிந்து விடும்.

    1. http://www.ethirkkural.com/2010/05/evolution-stheory-harry-potter-stories_29.html
    Evolution St(he)ory > Harry Potter Stories – II
    ***************
    இது டாக் ஆர்ஜின் தளத்தின் விமர்சனத்தை திரித்து எழுதப் பட்டது.ஒரு வார்த்தைக்கு பல அகராதிகளில் கொஞ்சம் வித்தியாசமான் விளக்கம் இருப்பது இயல்பு.இத்னை பரிணாம் என்பதே வரையறுக்கப் படாத குழப்பம் போல் காட்டுவதுதான் இந்த பதிவு.

    http://www.talkorigins.org/faqs/evolution-definition.html
    comparing different dictionary for evolution
    _____________
    2.Evolution St(he)ory > Harry Potter Stories – III
    http://www.ethirkkural.com/2010/07/evolution-stheory-harry-potter-stories.html

    cambrian evolution
    *******************
    கேம்பிரியன் எக்ஸ்ப்ளோசன் என்ற சான்றுகளை வைத்து அனைத்து உயிரினங்களும் ஒன்ராக் தோன்றியது என்று கூறுவது இத்தளத்தின் இக்கட்டுரையில் இருந்து.எடுக்கப் பட்டது
    http://www.talkorigins.org/indexcc/CC/CC300.html
    ______________________
    3.Evolution St(he)ory > Harry Potter Stories – IV
    http://www.ethirkkural.com/2010/07/evolution-stheory-harry-potter-stories_19.html
    Punctuated Equilibria:
    *******************
    பரிணாம் விஞ்ஞானிகள் சில விள்க்கங்களில் வேறுபடுவதை பரிணம்த்ஹ்டிற்கு எதிராக காட்டும் ஒரு முயற்சி.இது இங்கே இருந்து எடுக்கப் பட்டது.
    http://www.talkorigins.org/indexcc/CC/CC201_1.html
    _________________________

    4. Evolution St(he)ory > Harry Potter Stories – V
    பில்ட்டவுன் மனிதன் பித்தலாட்டம் (The Piltdown Man Forgery):
    http://www.ethirkkural.com/2010/09/evolution-stheory-harry-potter-stories.html
    ***********
    ம்னிதனின் முன்னோர் என்று நடந்த ஏமாற்று வேலை இங்கே இருந்து எடுக்கப் பட்டது.
    http://www.talkorigins.org/faqs/homs/a_piltdown.html
    _______________
    5.Evolution St(he)ory > Harry Potter Stories – VI
    நியாண்டர்தல் மனிதர்கள் (Neandertals or Neanderthals)
    http://www.ethirkkural.com/2010/10/evolution-stheory-harry-potter-stories.html
    *************
    மனிதன் போன்ர இன்னொரு இனமான‌ நியாண்டர்தால் பற்றி கூறுவது இங்கிருந்து எடுக்கப் பட்டது.
    http://www.talkorigins.org/faqs/homs/armor.html
    _____________
    6.Evolution St(he)ory > Harry Potter Stories – VII
    http://www.ethirkkural.com/2010/12/evolution-stheory-harry-potter-stories.html
    பழமையான பூச்சி என்றால் அது Rhyniognatha hirsti
    ***********
    இது மட்டும் கொஞ்சம் தெளிவாக இங்கு எடுக்கப் பட்டதா என்று கூர இயலாது.
    இதுவும் அது போன்ற கருத்தையே கூறுகின்றன.
    http://www.talkorigins.org/indexcc/CC/CC220_1.html
    ____________

    ஆக் இதில் இருந்து டாக் ஆர்ஜின் தளத்தின் படைபியல் குறித்த விளக்கங்கள் சகோ ஆஸிக் அகம்திற்கு பயன் தரும் வண்னம் இருந்ததை விள்க்கினோம்.
    இதற்கு மேலும் டாக் ஆர்ஜின் தளம் ப்ரிணாம்த்திற்கு மட்டும் ஆதர்வானது என்றால் ஆஸிக அகம்து பரிணாம் ஆதரவாளர் ஆகி விடுவார்!!!!!!!!!.
    ஹா ஹா ஹா

    ஒரு உணவக்த்தில் பல பண்டங்கள் இருந்தாலும் வெஜிடேரியன் காய்கரி உணவும்,நான் வெஜிடேரியம் மாமிச உணவு சாப்பிடுவது போல் இந்த டாக் ஆர்ஜின் தளத்தை எவரும் எப்படி பயன் படுத்த முடியும்.!!!!!!!!!!!!!!!!

    இன்னும் விவாதிப்பதென்றால் பதிவுகளுக்குள் சென்று அவர் குறிப்பிட்ட விவரங்களுக்கு டாக் ஆர்ஜின் தள்த்திலேயே எதிர் விளக்கம் உன்டு அதனையும் தர தயாராக் இருக்கிறோம்!!!!!!!!!!
    இப்பதிவுகளுக்கு மறுப்பு தெரிவிக்க ஆங்கிலம் தெரிந்த எவரும் போதும்!!!!!!!!!!!!

  29. சலாம் சார்வாகன்,

    ///1.இது ஒரு Usenet newsgroup.பலரின் கருத்து பகிரும் தளம் என்று மொழி பெயர்க்கலாம்.
    சொல்லுங்கள் ஆம்/இல்லை////நான் சொல்ல வருவது என்ன வென்றால் இந்த தளத்தில் உள்ள பல கட்டுரைகள்
    பரிணாம்ம்,படைப்பியல்,மதம் என்று பல விஷயங்களை பற்றி எவர் வேண்டுமானாலும் பதிவிடலாம்///யார் வேண்டுமானாலும் எழுத முடியும்,பதிவிட முடியும் என்னும் போது இந்த தளம் பற்றி என்ன கூற முடியும்?.It is just an Usenet newsgroup.////

    இல்லை. உங்கள் அறியாமையை திரும்ப திரும்ப காட்டுகின்றீர்கள்.

    இதுக்கு தானே, “முதல்ல போய் talkorigins archive என்பதற்கும், talk.origins என்பதற்கும் என்ன வித்தியாசம்னு தெரிஞ்சுட்டு வாங்க (முதல் பக்கத்துலேயே தெளிவா சொல்லிருக்காங்க). நீங்க அறியாமைல உளருரதுக்கு எல்லாம் என்னால் பதில் சொல்லிட்டு இருக்க முடியாது” – இப்படி சொன்னேன்…

    talk.origins என்பது usenet newsgroup. அதில் கருத்துக்களை பகிரலாம். ஆனால் talkorigins archive என்பது அப்படியெல்ல. Talkorigins.org என்றால் Talkorigins archive பற்றி பேசுராங்கன்னு அர்த்தம்.

    யார் வேண்டுமென்றாலும் பகிரும் ஒரு தளத்தை NAS, Scientific American, NCSE போன்றவர்கள் ஆதரிப்பார்களா?. யோசிக்க மாட்டீர்களா?
    யார் வேண்டுமென்றாலும் பகிரும் ஒரு தளத்தின் தகவல்களை கல்வி நிறுவனங்கள் தங்கள் பாட நூல்களில் சேர்ப்பார்களா? யோசிக்க மாட்டீர்களா?

    மறுபடியும் சொல்கின்றேன், போய் இரண்டிற்கும் உள்ள வித்தியாசங்களை தெரிந்து கொண்டு வாருங்கள். நீங்க அறியாமைல உளருரதுக்கு எல்லாம் என்னால் பதில் சொல்லிட்டு இருக்க முடியாது

    ////அதன் தலைவர்கள் பற்றிய சுட்டிகள் அளித்தேன் படித்துப் பாருங்கள்.`///

    ஒரே ஒருவர் பற்றிய லிங்க் கொடுத்தீர்கள். அதில் நான் கேட்டது இல்லை என்பதாலேயே திரும்பவும் கேட்டேன். அந்த லிங்கில் அவர் பரிணாம எதிர்ப்பாளர் என்று எங்கு இருக்கின்றது?. மாறாக, பரிணாமத்திற்கு எதிரான கருத்துக்களை விமர்சித்தவர் என்று தான் இருக்கின்றது. “he took up criticizing antievolution claims in letters to the editor of newspapers and in online fora.” – இப்படி.

    அப்புறம், ////அதனை நடத்துபவர்கள் அனைவருமே பரிணாம‌ எதிர்ப்பாளர்கள்/// – இதையும் நீங்க தானே சொன்னீங்க. இதையும் நிரூபியுங்க..

    ////மேலே கண்ட இரு கட்டுரைகளும் பரிணாமத்தை ஆதரிக்கிறது என்று கூறுவீர்களா?////

    சீரியசா, இதுக்கு என்ன பதில் சொல்றதுன்னு தெரில…ஐயா நீங்க கொடுக்குற லிங்குகளை படிச்சு பாக்குறதே இல்லையா??. நீங்க கொடுத்த இரண்டு லின்க்கும் பரிணாமத்துக்கு ஆதரவாக பேசும் லிங்க்குகள்.

    ////A)The Bible predicts what we should see in the Fossil Record.Post of the Month: March 2011 by Randy Crum http://www.talkorigins.org/origins/postmonth/2011_03.html///

    இந்த லின்க்கில், பைபிள் தகவல்களை விமர்சித்திருக்கின்றார்கள். அதாவது, பைபிள் உண்மையாக இருந்தால் உயிரினப்படிம ஆதாரங்கள் எப்படியெல்லாம் இருந்திருக்க வேண்டும் என்று சொல்லி, கடைசியில் பைபிள் சொல்வது பொய் என்று முடிக்கின்றார்கள். பாருங்கள் ///In fact, of course, it exists nowhere on Earth. Creationism –> totally falsified by the fossil record.///

    அதாவது, உயிரினப்படிமங்கள் படைப்புவாதத்தை பொய்பிக்கின்றன என்று சொல்லி முடித்துள்ளார்கள். இது உங்களுக்கு பரிணாம எதிர்ப்பு கட்டுரையா?. லிங்க் கொடுக்குரதுக்கு முன்னாடி சிந்திக்கவே மாட்டீர்களா?

    அடுத்து நீங்க கொடுத்த லிங்க்..

    ///http://www.talkorigins.org/indexcc/CC/CC300.html. Complex life forms appear suddenly in the Cambrian explosion, with no ancestral fossils.///

    மற்றுமொரு crap. போய் நீங்களே படிச்சு பாருங்க. படைப்புவாதிகளின் ஒரு விமர்சனத்துக்கு (claim) பதில் சொல்லி இருக்கின்றார்கள் அந்த லிங்கில். படைப்புவாதிகள் சொல்கின்றார்கலாம் “Complex life forms appear suddenly in the Cambrian explosion, with no ancestral fossils”. இந்த விமர்சனம் எங்கிருந்து எடுக்கப்பட்டது என்று சொல்லி, படைப்புவாதிகளின் இந்த விமர்சனத்திற்கு பதில் சொல்லி இருக்கின்றார்கள் அந்த லிங்கில்.

    இது உங்களுக்கு பரிணாம எதிர்ப்பு கட்டுரையா?. லிங்க் கொடுக்குரதுக்கு முன்னாடி சிந்திக்கவே மாட்டீர்களா?

    ////இந்த கேம்பிரிட்ஜ் என்ஸ்ப்ளொஸன் பற்ரிய கட்டுரை ஒரு படைப்பியல் கருத்தை வழி மொழிகிறதா இல்லையா? /There are transitional fossils within the Cambrian explosion fossils.//////

    இது படைப்பியல் கருத்தா?? போங்கப்பா…எரிச்சலா வருது உங்க அறியாமையை நினைத்தா…

    ////டாக் ஆர்ஜினில் பரிணாம விமர்சன கட்டுரை காண்பித்தாயிற்று.///

    இல்லை. நீங்க காட்டவில்லை. எங்களை ஏமாற்றுகிண்றீர்கள். உங்களை பொய்யர் என்று காட்டிருக்கிண்றீர்கள். நீங்க கொடுத்த இரண்டு லின்க்கும் பரிணாம எதிர்ப்பு கட்டுரை இல்லை. இரண்டுமே பரிணாம ஆதரவு கட்டுரை.

    அப்படி நான் சொல்வதில் நம்பிக்கை இல்லையென்றால், அந்த இரண்டு கட்டுரைகளையும் தமிழில் மொழிபெயருங்கள். அப்போது தெரிந்துவிடும் ,உங்களின் ஆங்கில புரிதல் எம்மாதிரியானது என்று.

    ////இது படைபியல்வாதிகளின் செயல்களை தொகுத்து அளிப்பது அவ்ர்களுக்கு செய்யும் மிகப் பெரிய தொண்டு ஆகும். http://www.talkorigins.org/indexcc/list.html#CB0///

    எத்தன முறை தான் உளருவீர்கள்???…..படைப்புவாதிகளின் பரிணாமம் மீதான விமர்சனங்களை தொகுத்து, அதற்கு பதில் கொடுப்பது யாருக்கு செய்யும் தொண்டு?…பரிணாமத்திற்கா? அல்லது படைப்புவாததிற்கா?.

  30. சார்வார்கன் ஐயா,

    இப்பொழுது என்னுடைய கேள்விகள் அப்படியே இருக்கின்றன.

    1. அந்த தளத்தை நடத்துபவர்கள் எல்லாரும் பரிணாம எதிர்ப்பாளர்கள், கிருத்துவ படைப்புவாதிகள் என்று சொன்னீர்கள். அதற்கு இன்னும் ஆதாரம் கொடுக்கவில்லை.

    2. அந்த தளம் என்னவோ படைப்புவாதத்தை ஆதரிப்பது போன்று விக்கி லிங்க் கொடுத்தீர்கள். நீங்கள் சொன்னது தவறு என்பதற்காக அந்த விக்கி லிங்கில் நீங்கள் கொடுத்த தகவல்களை மொழிபெயர்க்க சொன்னேன். நீங்கள் இன்னும் செய்யவில்லை.

    3. அந்த தளம், படைப்புவாதத்தை ஆதரிக்கும் தளமாக இருந்தால், எதற்காக பிரசித்திப்பெற்ற ஆய்விதழ்களும், அறிவியல் நிறுவங்களும், கல்வி நிறுவங்களும் இந்த தளத்தை பரிந்துரைக்க வேண்டும்? அவர்களின் பாட புத்தகங்களில் இந்த தளத்தின் கட்டுரைகளை சேர்க்கவேண்டும்?

    4. இந்த தளத்தில் இருந்து ஒரே ஒரு பரிணாம எதிர்ப்பு கட்டுரை காட்ட சொன்னேன். உங்களை பொய்யர் என்று மறுபடியும் நிரூபித்தீர்களே தவிர அம்மாதிரியான கட்டுரைகளை இன்னும் காட்டவில்லை.

    இனி நீங்கள் என்ன லிங்க் கொடுத்தாலும், அதில் நீங்கள் சொல்ல நினைக்கும் முக்கிய கருத்தை அப்படியே ஆங்கிலத்தில் கொடுத்து பின்னர் அதை தமிழில் மொழிபெயர்த்து கொடுங்கள்.

    அடப்போங்கப்பா..நீங்களும் உங்க நம்பிக்கையும்….

    உங்கள் சகோதரன்,
    ஆஷிக் அஹமத் அ

  31. சகோதரர் சார்வாகன்,

    ஸலாம்…

    soldier3000 மற்றும் சார்வாகன் இருவரும் நீங்கள் தானா….

    இருவரும் ஒன்றென்றால் நீங்கள் உளறிகொட்டியதற்காக மேலே கேட்டுள்ள கேள்விகளுக்கு பதில்சொல்லவும்…

    இல்லையென்றால்

    சகோதரர் soldier3000,

    அஸ்ஸலாமு அலைக்கும்,

    சற்று மனதை சாந்தப்படுத்தி கொள்ளுங்கள். தாங்கள் இன்னொரு சார்வாகன் (உளறிகொட்டுவதில்) என்பதை நிரூபிக்க எனக்கு அதிக நேரம் ஆகாது. சார்வாகன் உளறிக்கொட்டியதாலேயே இங்கு வர வேண்டியதாக போய்விட்டது. அதற்கு இன்னும் அவர் பதில் தரவில்லை. ஒருவருடன் வாதம் நடந்து கொண்டிருப்பதால் தாங்கள் என்னை திசை திருப்ப வேண்டாம். எனக்கு அதற்கு நேரமும் இல்லை.

    அப்புறம், talkorigins தளத்தின் நம்பகத்தன்மை குறித்து இதுவரை நான் அறிந்து எந்தவொரு பரிணாம ஆதரவாளரும் கேள்வி கேட்டதில்லை. என்னுடைய harrypotter இராண்டாவது பதிவு மட்டுமே அத்தளத்தின் ஒரு பதிவை முழுவதுமாக மேற்கோளாக காட்டி விமர்சிக்கப்பட்டது.

    மற்ற பதிவுகளில் உள்ள references-களை பாருங்கள். உங்களுக்கு talkorigins தளம் மட்டும் கண்ணுக்கு தெரிந்தால் அதற்கு நான் பொறுப்பல்ல. அதுபோல நீங்கள் குறிப்பட்ட மற்ற பதிவுகள் அந்த தளத்தில் உள்ள பதிவுகளை தழுவி எழுதப்பட்டவையும் அல்ல.

    பரிணாமத்தை விமர்சிப்பதற்காக பல தளங்களை (ஆதரவு எதிர்ப்பு) பார்வையிடுகின்றேன். பல புத்தகங்களை படிக்கின்றேன்.

    ஒன்று குறித்து விமர்சிப்பதாக இருந்தால் அதற்கு ஆதரவு, எதிர்ப்பு என்று இரண்டு பார்வையையும் பார்க்கவேண்டும். அந்த காரணத்தினாலேயே talkorigins போன்ற கடுமையான பரிணாம ஆதரவு தளங்களின் நிலையையும் படிக்கின்றேன். பின்னர் என்னுடைய reference பகுதியில் நான் படித்த அந்த பரிணாம ஆதரவு தளங்களை குறிப்பிடுகின்றேன். அவ்வளவே.

    பதிவில் சொல்லப்பட்டுள்ள தகவல்கள் தவறென்றால் சுட்டிக்காட்டலாம். விமர்சனம் செய்யலாம். விசயம் முடிந்தது.

    நான் ஏற்கனவே சொல்லியது போன்று, தாங்கள் என்னை திசை திருப்ப வேண்டாம்.

    நான் இங்கு வந்தது ஒருவருடைய உளறலை சுட்டிக்காட்டவே. தகுந்த ஆதாரங்களுடன் தான் நான் சுட்டி காட்டி இருக்கின்றேன். அவர் என்னுடைய கேள்விகளுக்கு பதில் சொல்லட்டும்.

    நன்றி,

    உங்கள் சகோதரன்,
    ஆஷிக் அஹ்மத் அ

  32. @ஆஸிக் அகமது

    alk.origins என்பது usenet newsgroup மட்டுமே அதில் பல் நல க்ட்டுரைகள் இருந்தாலும்,இது சஞ்சிகைகளின் கட்டுரை போல் கருத முடியாது.

    /Talk.origins என்பது usenet newsgroup. அதில் கருத்துக்களை பகிரலாம். ஆனால் talkorigins archive என்பது அப்படியெல்ல. Talkorigins.org என்றால் Talkorigins archive பற்றி பேசுராங்கன்னு அர்த்தம்./
    _________
    ஆர்கிவ் என்றால் என்ன?
    காப்பகம்.அதில் உள்ள கட்டுரைகள் பல்வற்றை பாது காத்து வைக்கிற் தொகுப்பு என கொள்ளலாம்.இதில் என்ன வித்தியாசம் கண்டீர்கள் என தெரியவில்லை.
    தளத்தின் பெயர் talkorigins archive
    இணைய தளம் http://www.talkorigins.org/
    _______
    இத்தளத்தில் உள்ள கட்டுரைகள் பல படைபியல்வாதிகளுக்கு திரித்து கூற உதவியாக் இருப்ப்தால் மட்டுமே இந்த அளவு விவாதிக்கிறீர்கள்.

    இத்தளத்தில் உள்ள்தை ம்ட்டும் பரிணாம் அறிவியலாளர்களின் கருத்தாக காட்ட முயல்வது தவறு.
    _________
    வேண்டுமானால் உங்கள் பரிணாமம் பற்றிய விள்க்கமே தெளிவற்றது என்ற பதிவு டாக் ஆர்ஜினின் கட்டுரையின் திரித்துக் கூறப்பட்ட வடிவம்.
    இது talk aargin archive எடுக்கப் பட்டதுதானே!!!!!
    http://www.talkorigins.org/faqs/evolution-definition.html
    comparing different dictionary for evolution
    _______________
    டாக் ஆர்ஜின் தளம் பலரால் பல்விதமாக் பயன் படுத்தப்படுவதாலும்,அதில் உள்ள கட்டுரைகள் சோதிக்கப் படாமல் ஆய்வு சஞ்சிகைகள் போல் கருத முடியாது.நீங்கள் வேண்டுமானால் உங்கள் கட்டுரையையும் பதிவிட முடியும்.ஆனால் இந்த விதிகளுக்க் உட்பட்டு இருக்க வேன்டும்.

    http://www.talkorigins.org/origins/faqs-submit.html

    Submission Guidelines

    Before submitting a prospective article or FAQ to the Talk.Origins Archive, ask yourself the following questions:

    Does my submission discuss an issue that comes up frequently (or periodically) in the evolution-creationism debate?
    Does my submission cover a topic not already dealt with by another FAQ in the archive?
    Is my submission concisely written in language that an educated layperson can understand?
    Does my submission provide the background information necessary to understand its reason for being a FAQ?
    Does my submission adequately deal with all issues relevant to the topic it covers (including creationist arguments and responses, if any)?
    If my submission is technical in nature, does it provide references to other detailed works on the subject?
    If the answer to these questions is yes, then post your submission to the newsgroup talk.origins requesting comments and criticism. (If you are unfamiliar with Usenet, you can read and post to talk.origins through Google, here; as a last resort, send your submission to submissions@talkorigins.org, and the site maintainers will collect comments and send them to you.) Talk.origins readers make up the informal FAQ review committee, and many of them will be happy to provide you with constructive input. Next, revise your submission based on the talk.origins readers’ comments. Repeat this process until there is general agreement that a satisfactory final result has been achieved. Submit the final revision of your FAQ to submissions@talkorigins.org.
    __________
    உங்கள் கட்டுரைகளை மொழி மாற்றம் செய்து talk orgin archive அனுப்புங்களேன் ,என்ன நடக்கிறது என்று பார்க்கலாம்.
    வாழ்த்துகள்

  33. அஸ்ஸலாமு அலைக்கும்,

    ஓகே சார்வாகன். வந்த வேலை முடிந்தது…எல்லாப் புகழும் இறைவன் ஒருவனுக்கே உரித்தாவதாக…ஆமீன்..

    நன்றி…

    உங்கள் சகோதரன்,
    ஆஷிக் அஹமத் அ

  34. சகோ. சந்கடி,

    பொதுவாக எந்த ஒரு கொள்கையாக இருந்தாலும் அதன் அடிப்படையிலிருந்து வாதிடுவதே முறை. அதை பரிணாமம் பற்றிய என்னுடைய பதிவுகள் பறைசாற்றும்.

    பரிணாமத்தின் அடிப்படைக்கு செல்வதானால், ஒரு மரபு இன்னொரு வடிவமைக்க பட்ட மரபாக மாற அல்லது அதன் மேல்நிலையை அடைய வாய்ப்பே இல்லை. இதை முதலில் நங்கு அறிந்தவரிடம் சென்று உறுதி படுத்தி கொள்ளுங்கள்.

    இது எத்தனை கோடி வருடங்கள் ஆனாலும் ஒரு உயிரி வீணாக வேண்டுமானால் போகும், அதன் அடுத்த நிலையை அடையும் என்பது வெறும் கற்பனையே, இதையே நாம் பல வகையாக விளக்கியுள்ளோம்.

    அடிப்படையே இல்லையாம், பிறகு உயிரின் உடலில் உள்ள லட்ச கணக்கான தொழிற் நுட்பத்திற்கு வழியென்ன.????

    யாராவது சரியான ஆதாரம் தருவார்களாவென்று காத்திருக்கிறேன், இதுவரை மலுப்பியது மட்டுமே பாக்கி.

    கார்பன் கூட்டாளி
    http://www.carbonfriend.blogspot.com

  35. இறைவனை ஏன் நம்ப மறுக்கின்றீர்?

    இப்போது அவன் வசிப்பது சிங்கப்பூரில்?

  36. நண்பர் கார்பன் கூட்டாளி (பெயர்க் காரணம் தெரிந்து கொள்ளலாமா?)

    உங்கள் தளத்தை இப்போது தான் பார்க்கிறேன். இரண்டு கட்டுரைகள் படித்திருக்கிறேன். தொடர்கிறேன்.

    ஒரு வகைப்பட்ட மரபணு, இன்னொரு வகைப்பட்ட மரபணுவாக மாற வேண்டுமா? எல்லா உயிர்களுக்கும் மரபணு கட்டமைப்பு ஒரே மாதிரியானது தான். அதில் பொதிந்திருக்கும் செய்திகளில் தான் வித்தியாசம் இருக்கிறது. பரிணாமம் என்பது பிரதியெடுத்தலின் போது நிகழும் பிழைகளின் தொடர்ச்சி. ஏற்பட்ட பிழையின் படியான மாற்றம் வாழ்தலின் தகவமைப்புக்கு பொருந்துகிறதா இல்லையா என்பதே விசயம்.

    குரோமோசோம்கள் எண்ணிக்கை கூடுதல் குறைவாக ஆக முடியாதா? குரோமோசோம்களில் இருக்கும் ஜீன்களின் எண்ணிக்கையில் வித்தியாசம் இருக்கிறது என்பதை நீங்கள் அறிவீர்கள். எக்ஸில் இருக்கும் எண்ணம் ஒய்யில் இருக்கவில்லை. அண்மை ஆய்வுகளில் ஒய்யில் இருக்கும் ஜீன்களின் எண்ணிக்கை குறைவதாக கூறியிருக்கிறார்கள். சில லட்சம் ஆண்டுகளுக்குப் பிறகு ஒய் குரோமோசோமே இல்லாமல் ஆகக்கூடும் என்கிறார்கள். ஆக தனித்தனியான விசயங்களை ஒன்றிணைத்து கட்டுரையாக்கி இருக்கிறீர்கள்.

    பொதுவாக படைப்புவாதிகள் பரிணாமக் கொள்கையை விரிவாக அலசி ஆராய்ந்து; சில இடங்களில் விமர்சனங்கள் எழுந்திருக்கின்றன. சில இடங்களில் பதிலளிக்கப்படாத கேள்விகள் இருக்கின்றன, எனவே, பரிணாமக் கொள்கையே தப்பு என்கிறார்கள். பரிணாமக் கொள்கை என்பது அறிவியல் அதில் எதிர்க் கேள்விகள், விமர்சனங்கள் உட்பட எல்லாவற்றுக்கும் இடமுண்டு. ஆனால் பரிணாமக் கொள்கையை நோக்கி கேள்வி எழுப்பும்போது படைப்புக் கொள்கையையும் கேள்விக்கு உள்ளாக்கும் கடமையும் அவர்களுக்கு இருக்கிறது. எந்தக் கேள்விகளுக்கும் அப்பாற்பட்டதாக படைப்புக் கொள்கையை பாதுகாத்துக் கொண்டு பரிணாமக் கொள்கையில் கேள்வி எழுப்பும் தார்மீகம் அவர்களுக்கு இல்லை.

    பரிணாமம் என்பது அறிவியல், படைப்பு என்பது வெறும் நம்பிக்கை. ஒப்பீடு என்று வந்துவிட்டால் வெகு நிச்சயமாக அறிவியலின் முன் வெற்று நம்பிக்கை நிற்கமுடியாது. அங்கே விமர்னம், இங்கே பதிலில்லை என்று பரிணாமமே தப்பு எனக் காட்டுபவர்கள், படைப்புக் கொள்கைக்கு ஒற்றை ஒரு அறிவியல் சான்றேனும் இருக்கிறதா என்பதை உள்வசமாய் சிந்திக்க வேண்டும்.

    படைப்பா? பரிணாமமா? இரண்டில் எது சரி?

  37. உங்களின் மீது ஏக இறைவனின் அமைதி நிலவட்டுமாக.

    //(பெயர்க் காரணம் தெரிந்து கொள்ளலாமா?)//

    கார்பனே அனைத்திற்கும் அடிப்படை, அதைபற்றிய மிகுந்த ஆவல்.அதுவே காரணம்.

    //ஒரு வகைப்பட்ட மரபணு, இன்னொரு வகைப்பட்ட மரபணுவாக மாற வேண்டுமா? எல்லா உயிர்களுக்கும் மரபணு கட்டமைப்பு ஒரே மாதிரியானது தான். அதில் பொதிந்திருக்கும் செய்திகளில் தான் வித்தியாசம் இருக்கிறது.//

    இல்லை சகோதரர். கட்டமைப்பு ஒரே மாதிரி தான், அதில் பொதிந்துள்ள தகவல்கள் வேறு, அந்த மாற்றதினாலேயே நாம் இப்போது உடலளவில் மாற்றம் கொண்டுள்ளோம்.
    ஆனால் அடிப்படை நான்கு அமிலம் மட்டுமே,

    a-adenine,
    t–tymine or u-uracil,
    g-guanine
    c–cytocine

    ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCC
    CCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGC
    CTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGG
    AAGCTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGACAGAATGCC
    CTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGCTCACGCAAG
    TTTAATTACAGACCTGAA

    இது சாம்பில் கட்டமைப்பு, உடலில் உள்ள அனைத்து தகவலும் இப்படி தான் பதிந்திருக்கும், இந்த அமிலங்கள் மூன்று மூன்றாக ஒன்றிணைத்து ஒரு புரதத்தை உருவாக்கும், அதுவே பிறகு கை கால் மற்றும் அனைத்து உறுப்புகளும் உருவாக காரணம்.

    // பரிணாமம் என்பது பிரதியெடுத்தலின் போது நிகழும் பிழைகளின் தொடர்ச்சி. ஏற்பட்ட பிழையின் படியான மாற்றம் வாழ்தலின் தகவமைப்புக்கு பொருந்துகிறதா இல்லையா என்பதே விசயம் //

    பிழைகள் பிரதி எடுக்கும் போது நிகழ்வதில்லை, அசாதாரண chemical உடம்பில் படுவதினாலோ, x ray, அகச்சிவப்பு, புற ஊதா கதிர்களின் பாதிப்புனாலேயே நிகழ்கிறது. இது போன்ற பாதிப்புகளினால் நமக்கு நோய் ஏற்படும், சில நேரம் அந்த பாதிப்புகள் அதிகரிக்க அது மேலே கொடுக்கப்பட்டுள மரபணுவை சிதைக்கும், இதன் உச்ச கட்டமே புற்று நோய் போன்ற வியாதிகள், ஆக பிழைகளினால் செல்கள், மரபணு பாதிக்குமே தவிர, அதன் மேல் நிலையை அடையாது, இந்த மரபணு பிழைகளையும் சரி செய்யவே DNA repair செய்யகூடிய புரதம் நம் உடலில் இருந்து அனைத்து செல்களில் நடவடிக்கைகளை கவனித்து கொண்டு, திடிரென ஏற்படும் தவறுகளை சரி செய்கிறது.
    ஆக இருப்பது வீணாக போகுமே தவிர மேல் நிலையை அடையாது…………………..

    // குரோமோசோம்கள் எண்ணிக்கை கூடுதல் குறைவாக ஆக முடியாதா? குரோமோசோம்களில் இருக்கும் ஜீன்களின் எண்ணிக்கையில் வித்தியாசம் இருக்கிறது என்பதை நீங்கள் அறிவீர்கள்//

    குரோமோசோம்களின் எண்ணிக்கை கூடுதலாக குறைவாக ஆகாது. மரபுகளின் எண்ணிக்கை மட்டுமே வித்தியாசம், அது உருவாக்கியவனின் அளவுகோல் என்பது என்னுடைய கருத்து.

    // பொதுவாக படைப்புவாதிகள் பரிணாமக் கொள்கையை விரிவாக அலசி ஆராய்ந்து; சில இடங்களில் விமர்சனங்கள் எழுந்திருக்கின்றன. சில இடங்களில் பதிலளிக்கப்படாத கேள்விகள் இருக்கின்றன, எனவே, பரிணாமக் கொள்கையே தப்பு என்கிறார்கள்//

    அதன் அடிப்படையே பதிலைக்க படவில்லை தவறு எனில் பிறகு எதற்கு அந்த கொள்கை.

    // பரிணாமக் கொள்கை என்பது அறிவியல் அதில் எதிர்க் கேள்விகள், விமர்சனங்கள் உட்பட எல்லாவற்றுக்கும் இடமுண்டு. ஆனால் பரிணாமக் கொள்கையை நோக்கி கேள்வி எழுப்பும்போது படைப்புக் கொள்கையையும் கேள்விக்கு உள்ளாக்கும் கடமையும் அவர்களுக்கு இருக்கிறது. //

    பரிணாம கொள்கை அறிவியளல்ல, நம்பிக்கை சார்ந்தது மட்டுமே, படைப்பு கொள்கையை நோக்கி கேள்விகள் எழுப்ப வேண்டாம் என்று யாரும் கூறவில்லை, சரியான கண்ணோட்டத்தில் பாருங்கள் என்றே கூறுகின்றோம். அர்த்தமுள்ள வாதங்களை வையுங்கள் என்றே கூறுகின்றோம்.

    // எந்தக் கேள்விகளுக்கும் அப்பாற்பட்டதாக படைப்புக் கொள்கையை பாதுகாத்துக் கொண்டு பரிணாமக் கொள்கையில் கேள்வி எழுப்பும் தார்மீகம் அவர்களுக்கு இல்லை.//

    உண்மையில் பரிணாமத்தில் தான் கேள்விக்கு பதில் இல்லை, இன்னும் உயிரினத்தின் அடிப்படை கூட சரியாக கூறப்படவில்லை, படைப்பு வாதம் இதற்கு காரணம் இறைவனின் படைப்பு என்று முடித்து விட்டது, அதற்கு மேல் நாம் அறிந்திருக்க வில்லை என்பதே உண்மை, இதை வைத்து கொண்டு பதிலில்லை என்று கூறுவது வேடிக்கையானது.

    // பரிணாமம் என்பது அறிவியல், படைப்பு என்பது வெறும் நம்பிக்கை. ஒப்பீடு என்று வந்துவிட்டால் வெகு நிச்சயமாக அறிவியலின் முன் வெற்று நம்பிக்கை நிற்கமுடியாது.//

    பரிணாமத்திற்கு ஆதாரம் கேட்டல் படைப்பு வாதத்தை தவறு என்று கூறுகிறீர்கள், இரண்டிற்கும் அடிப்படை நம்பிக்கை மட்டுமே,

    // அங்கே விமர்னம், இங்கே பதிலில்லை என்று பரிணாமமே தப்பு எனக் காட்டுபவர்கள், படைப்புக் கொள்கைக்கு ஒற்றை ஒரு அறிவியல் சான்றேனும் இருக்கிறதா என்பதை உள்வசமாய் சிந்திக்க வேண்டும்.
    படைப்பா? பரிணாமமா? இரண்டில் எது சரி?//

    ஆக பரிணாமம் அடிப்படை இல்லை என்பதை ஒப்பு கொள்கிறீர்கள், தவறேன்கிற போது முதலில் பரிணாமத்தை மூட்டை கட்டுங்கள், சரி படைப்பு வாதத்திற்கு வருவோம், படைப்பு வாதத்திற்கு ஆதாரம் வேதங்கள் மட்டுமே, நீங்கள் அதிகம் விமர்சனம் செய்யும் குர்ஆனின் படைப்பு வாதத்தில் எந்த ஒரு தவறையும் நான் கண்டதில்லை, உங்களுடைய தனிப்பட்ட கோபத்தை விளக்கி வைத்து விட்டு மறுமுறை படியுங்கள்.

    பரிணாமத்தை ஓரங்கட்டி விட்டால் படைப்புவாததை பற்றி உங்களுக்கு விளக்க ஏதுவாக இருக்கும், பரிணாமத்தை திரும்பவும் தாங்கி பிடித்தால் முதலில் அதை முழுமையாக விளக்குகிறேன். பொய் என நிரூபிக்கிறேன், பிறகு படைப்பு வாதத்திற்கு வரலாம்.

  38. ஆஹா கார்பன் கூட்டாளி வந்துவிட்டார்.

    இவரோட பதிவில போய் எந்த கமெண்டை போட்டாலும் அனுமதிக்க மாட்டார்.
    இவரோட பதிவுக்கு எழில் என்பவர் பதில் எழுதினார்.

    கார்பன் கூட்டாளி என்ற புளுகுமூட்டை பதிவர்

    http://ezhila.blogspot.com/2011/06/blog-post_9085.html

    அதனை கண்டுகொள்ளவில்லை. தான் பிடித்த முயலுக்கு மூன்றுகால் என்று சொல்பவர் இவர்

    குரோமசோம் எண்ணிக்கை மாறினால் இனப்பெருக்கம் செய்யமுடியாது என்று சொன்னதை எழில் தவறு என்று நிரூபித்தார்.

    இவரிடமிருந்து மன்னிப்போ, திருத்தமோ எதுவும் வரவில்லை.

    இதுதான் இவரது யோக்யதை

  39. நண்பர் கார்பன் கூட்டாளி,

    மரபணுச் செய்திகள் பிரதியெடுக்கப்படும் போது பிழைகள் நிகழ்வதில்லை என்கிறீர்கள். இது சரியா? அல்ல, பிரதியெடுக்கும் போதும் பிழைகள் நிகழ்கின்றன. பிறவியிலேயே ஏற்படும் பிரச்சனைகளுக்கு வேறு என்ன காரணம் இருக்க முடியும்? பன்றிக்கு யானைக்குட்டி பிறந்திருக்கிறது என்பார்கள், பார்த்தால் மூக்கு சற்று நீண்டிருக்கும். தேவையற்ற உறுப்புகள், அவசியமற்ற நீட்சிகள், வெளிப்புறக் கட்டிகள் என்று அன்றாடம் மனிதர்களுக்கும் விலங்குகளுக்கும் பிறவியிலேயே சில பிரச்சனைகள் ஏற்படுகின்றன. பிரதியெடுக்கும் போது பிழைகள் நேராது என்றால் இவைகள் நேர்வதற்கான வாய்ப்பில்லை. நீங்கள் கூறும் நோய்களும் இவைகளும் ஒன்றல்ல.

    ஒய் குரோமோசோம்கள் 15லிருந்து 30 கோடி ஆண்டுகளுக்கு முன் உருவாகும் போது ஆயிரத்திற்கும் மேற்பட்ட மரபணுக்கள் இருந்தன என்றும் தற்போது நூற்றுக்கும் குறைவாக உள்ளன என்றும் தற்போது கணக்கிடப்பட்டுள்ளது. காலப்போக்கில் இந்த மரபணுக்களும் குறைந்தால் ஒய் குரோமோசோம் என்னவாகும்?

    பரிணாமமா? படைப்பா? இது இரண்டுமே நம்பிக்கைகள் என்று போகிற போக்கில் கூறிவிட முடியாது. பரிணாமம் குறித்து எவ்வளவு அறிவியல் ஆய்வுகள் நடந்திருக்கின்றன என்பது எங்களைப் போன்றவர்களைவிட உங்களைப் போன்றவர்களுக்கே அதிகம் தெரிந்திருக்கிறது. படைப்பு குறித்து என்ன அறிவியல் ஆய்வுகள் நடந்திருக்கின்றன கூற முடியுமா? கவனிக்கவும் பரிணாமத்தில் இன்னும் நிறைய பயணப்பட வேண்டியதிருக்கிறது. அதிகம் விமர்சிக்கப்படுகிறது. கேள்விகள் எழுப்பப்படுகிறது. ஆனால் படைப்புக் கொள்கைதான் சரியானது பரிணாமக் கொள்கை தவறு என்று எந்த அறிவியலாளரும் கூறவில்லை. சில குறைகள் இருந்தாலும் இன்றைய தேதியில் பூமியின் உயிர்ப் பரவலை விளக்கும் அறிவியல் கொள்கை வெறொன்று இல்லை.

    நீங்கள் பரிணாமத்தை விமர்சிக்கலாம் அதில் தவறொன்றுமில்லை. அறிவியலாளர்களும் விமர்சிக்கிறார்கள். ஆனால் அந்த விமர்சனங்களைக் கொண்டு பரிணாமமே தவறானது என்று இன்றைய நிலையில் யாராலும் கூறவியலாது. ஏனென்றால் உயிரியல் ஆய்வுகள் அனைத்தும் பரிணாமப் படிநிலையில் இருந்து தான் செய்யப்படுகின்றன.

    பரிணாமத்திற்கு ஈடாக படைப்பும் பரிசீலனைக்கு எடுத்துக் கொள்ளப்பட வேண்டுமென்றால் அது மெய்யாக இருக்கக் கூடும் என்பதற்கு குறைந்தபடச அறிவியல் சான்றேனும் தேவை. அப்படி ஏதேனும் இருக்கிறதா? இருந்தால் கூறுங்கள். மாறாக பரிணாமத்தை விமர்சிக்கிறார்கள் என்பதை மட்டுமே சுட்டிக் காட்டி, உங்களைப் போன்றவர்கள் கூறுவது போல் பரிணாமம் தவறு படைப்பு தான் சரி என்று கூறவியலாது.

  40. first analysis about islam and then write your article ………

  41. நம் அனைவர் மீதும் ஏகனின் சாந்தியும் சமாதானமும் நிலவட்டுமாக!
    சகோ செங்கோடி அவர்களுக்கு ,
    நான் பலமுறை உங்கள் தளத்தை பார்வையிட்டாலும் – பின்னூட்டமிட்ட்தில்லை ஏனெனில் எதைக்குறித்து நாம் கேள்வி எழுப்பினாலும் பதில் அக்கருப்பொருளை தாண்டி தான் தொடர்கிறது. புரிதலற்ற இஸ்லாமிய பதிவுகளுக்கு அவ்வபோது நான் அறிந்த வரையில் நான் முஸ்லிம் தளத்தில் விளக்கமும் எழுதி வருகிறேன்., சகோ ஒருவர் எனகிட்ட மெயில் வாயிலாக இங்கு வந்தேன்., இறை நாடினால் நான் முஸ்லிம் தளத்தை பாருங்கள்; பரிணாமம்/ நாத்திகம் குறித்த தர்க்கரீதியாக அங்கு எழுப்பப்படும் கேள்விகளுக்கு பதில் தாருங்கள்,
    குறிப்பாக.,

    கடவுள் வேண்டாம் என்றால் எப்படிப்பட்ட கடவுள் வேண்டாம் ?- வேண்டாத கடவுளின் இலக்கணம்?
    http://iraiadimai.blogspot.com/2011/07/blog-post.html

    கடவுளில்லா உலகத்தில் அனைத்து மக்களுக்கும் சமமான நீதி வழங்க முடியுமா?
    http://iraiadimai.blogspot.com/2010/08/blog-post_15.html

    பரிணாமம் -மனித பண்புகள் குறித்து சிலவினாக்கள்
    http://iraiadimai.blogspot.com/2010/12/blog-post_27.html

    எதை அடிப்படையாக வைத்து நம் வாழ்வின் நனமை /தீமைகள் மேற்கொள்ளுவது?
    http://iraiadimai.blogspot.com/2010/11/blog-post_12.html

    மேலும் ஏனைய ஆக்கங்களை பாருங்கள்., அனைத்துமே தர்க்க ரீதியான வாதங்களையை அடிப்படையாக கொண்டது தான் பதில் தருவீர்களே என நம்புகிறேன்

    எனக்கு வேலைப்பளு அதிகமாக இருப்பதால் அவ்வளவாக இணையத்தில் இணையமுடியாது., பதிலிட்டபின் எனக்கு மெயிலிடுங்கள்

    இறை நாடினால் இனியும் சந்திப்போம்

  42. உங்கள் அனைவரின் மீதும் ஐம்பதாயிரம் ஒளிவருட தொலைவில் அமர்ந்திருக்கும் அல்லாஹ்வின் சாந்தியும் சமாதானமும் நிலவுவதாக (என்ன அந்த சாந்தியும் சமாதானமும் உங்களிடம் வந்து சேர்வதற்கு கொஞ்சம் நேரமாகும்)

    கார்பன் கூட்டாளி பதிவரின் தோண்டித்தோண்டி எடுத்த அல்லாஹ்வின் அருமை பெருமைகளை விளக்கி நானும் ஒரு ஆதரவு பதிவு எழுதியுள்ளேன்.

    உங்கள் கருத்துக்களை தெரிவிக்க கோருகிறேன்
    அல்லாஹ்வின் கிரகம் இருக்கும் இடத்தை அறிந்த கார்பன் கூட்டாளி

    யா அல்லாஹ்
    அல்ஹம்துலில்லாஹ்

  43. மனிதனை இறைவன் நீரிலிருந்தும் படைத்துள்ளான், மண்ணிலிருந்தும் படைத்துள்ளான்.

    சாம்பார் தயாரிக்க பருப்பும் தேவை, கத்திரிக்காயும் தேவை. இதிலென்ன குழப்பம்.

    ஓறெ மனிதனிலிருந்து மனிதன் வரவில்லை என்றால், ஏன் அஃப்ரிக்காவிலிருந்து வரவேண்டும். மொதல்லவெ, எல்லா ஊர்லயும் இருக்க வெண்டியது தானே.

    முஸ்லிம்கள், பரினாமத்தை முழுமையாக புரக்கனிக்கவில்லை. ஆனால், எல்லமே, பரினாமததால் தான் உண்டானது என்பது ஏற்கக தகுந்த வாதம் அல்ல.

    ஆனால், நீங்களோ நாத்திஹர்கள் குரானயும் குறை சொல்வீர்கள், பரிணாமத்தையும் புரிந்து கொள்ளும் விதத்தில் புரிய மாட்டீர்கள். இறைவனயும் அவன் தூதறையும் குரை சொல்ல உங்களுக்கு பரினாமம் ஒரு கருவி அவ்வளவு தான்.

    நீங்கள், ‘கடவுள் இல்லை’ என்பதையும் உற்தியாக நம்பவில்லை என்ன்பதே உன்மை.

    அறுபது அடி மனிதனை பார்க்கனுமா.
    http://urbanlegends.about.com/library/bl_giant_skeleton.htm

    மேலும், கூகுளில் பல தகவல்கள் உள்ளது. ஊண்மையை தேடி அறிந்துகொள்ளுங்கள்.

    ஏல்லாம் வல்ல அல்லாஹ்(ஏக இறைவன்) உங்களுக்கு நேர்வழி காடுவானாக.

  44. நண்பர் குலாம்,

    உங்கள் அறிமுகத்திற்கு நன்றி.
    வாய்ப்பு கிடைக்கும் போது உங்கள் பதிவை படித்து தேவைப்பட்டால் பதிலளிக்கிறேன். ஏனென்றால், பெரும்பாலான இஸ்லாமிய பதிவர்கள் ஓர் எதிர்கருத்து எனும் நிலையைத் தாண்டி இஸ்லாத்திற்கு எதிரான விமர்சனம் என்றாலே வன்மத்துடன் சொற்களை வீசுகிறார்கள். போகட்டும்.

    நீங்கள் சுட்டிய முதல் கட்டுரையை படித்துப் பார்த்தேன். நாத்திகர்கள் மறுக்கும் கடவுளுக்கான வரைவிலக்கணம் என்ன? என்பது உங்கள் மையமான கேள்வி. இது ஒரு குழப்ப வாதம். உங்களின் எடுத்துக் காட்டிலிருந்தே தொடங்கலாம். கையில் ஒரு பேனாவை பிடித்துக் கொண்டிருப்பதைப் போன்று பாவனை செய்து கொண்டு, இது பேனா, இது எழுதுவதற்கு உதவும் பொருள், மையை தேக்கிவைத்து சீராக கசியும் அமைப்புடன் தாளில் தீற்றும் உத்தியில் இது செயல்படுத்தப்படுகிறது. இதுதான் இது பேனா என்பதற்கான வரைவிலக்கணம். இப்போது என்கையில் பேனா இல்லை என்பவர்கள் அவர்கள் மறுக்கும் பேனாவிற்கான வரைவிலக்கணத்தைக் கூறட்டும். இப்படி ஒருவரால் கூறவியலுமா?

    ஒருவர் ஒரு பொருளுக்கு அல்லது ஒரு தன்மைக்கு இலக்கணம் கூறவேண்டும் என்றால் அந்தப் பொருள் அல்லது தன்மை இருப்பதாக அவர் ஏற்றுக் கொண்டாக வேண்டும். இது நேர்வாதம் எதிர்வாதம் எனும் இரண்டு நிலையிலும் பொருந்தும். அதாவது அந்த பொருள் அல்லது தன்மை எது குறித்தானது என்பதில் நேர்வாதமும் எதிர்வாதமும் இருந்து; அந்தப் பொருளின் அல்லது தன்மையின் இருப்பில் வாதமில்லாத நிலையில் நேர்வாதத்தின் சார்பிலும் எதிர்வாதத்தின் சார்பிலும் தனித்தனியே வரைவிலக்கணங்களை முன்வைத்து அது எத்தகையது என்பதை முடிவு செய்யலாம். ஆனால் அந்த பொருள் அல்லது தன்மை இருக்கிறதா இல்லையா என்பதில் வாதமிருக்கும் போது அங்கு வரைவிலக்கணம் தேவைப்படாது. மாறாக அந்தப் பொருள் அல்லது தன்மை என்ன என்பது விளக்கப்பட வேண்டும்.

    இப்போது உங்களின் கடவுள் பற்றிய வரைவிலக்கணத்திற்கு வருவோம். அவன் ஒருவன், தேவையற்றவன், பெறவும் இல்லை, பெறப்படவும் இல்லை, நிகரும் இல்லை. இது வரைவிலக்கணம் அல்ல. இது ஒப்பீடு. நீங்கள் குறிப்பிட்டுள்ளவை மனிதனின் வரைவிலக்கணத்தில் அடங்குபவை. மனிதனின் இலக்கணத்தோடு ஒப்பீடு செய்து இது இல்லாதது என்று கூறுவது. ஒரு வாதத்திற்காக, இதை வரைவிலக்கணம் என்று கொண்டாலும், அது எப்போது பொருந்தும்? கடவுள் என்று ஒருவன் இருக்கிறான் என்பதில் என்பதில் எந்த மறுப்பும் இல்லாத நிலையில் ஆனால் அவன் எத்தகையவன் என்பதில் மாறுபட்ட கருத்துகள் இருந்தால், அப்போது ஒரு தரப்பிற்கு ஆதரவாக இதை வரைவிலக்கணமாக பொருத்தலாம்.

    ஆனால் ஆத்திகர்களுக்கும் நாத்திகர்களுக்குமான பிரச்சனை இதுவல்ல. கடவுள் என்ற ஒன்று இருக்கிறதா இல்லையா என்பது தான் பிரச்சனை. இருக்கிறது என்பவர்கள் தான் அதற்கு வரைவிலக்கணம் கூறமுடியும். இல்லை என்பவர்கள் என்ன வரைவிலக்கணத்தை கூறுவது? இன்னின்ன இலக்கணங்கள் இல்லை என்றால் அதை மறுப்போம் என்று கூறமுடியுமா? ஆகவேதான் கூறுகிறேன் இது குழப்ப வாதம் என்று.

    கடவுள் என்றால் என்ன? கடவுள் என்ற ஒரு கருத்து உலவத் தொடங்கிய காலத்திலிருந்து அதன் மறுப்பாளர்களால் தொடர்ந்து கேட்க்கப்பட்டுக் கொண்டிருக்கும் கேள்வி இது. சற்றேறக்குறைய என்னிடம் கடவுள் குறித்து பேசும் அனைவரிடமும் இந்தக் கேள்வியை நான் கேட்டிருக்கிறேன். யாரும் பதில் கூறியதில்லை. இந்த பேரண்டத்தில் இருக்கும் அனைத்தையும் இரண்டு வகையாக பகுக்கலாம். ஒன்று, பொருள். இரண்டு, கருத்து. இந்த இரண்டும் இல்லாமல் வேறொன்று இருக்கிறது என்று நீங்கள் உட்பட யாராலும் கூறமுடியாது. இந்த இரண்டுக்கும் வரைவிலக்கணம் இருக்கிறது. பொருள் என்பது நான்கு பரிமாணத்தில் அடங்குவது, கருத்து என்பதற்கு பரிமாணம் தேவையில்லை என்றாலும் பொருளைச் சார்ந்து இலங்குவது. இந்த இரண்டைத்தவிர வேறொன்று இப்பேரண்டத்தில் இல்லை. யாரேனும் இந்த இரண்டல்லாத ஒன்று இருக்கக் கூடும் எனக் கூறுவார்களாயின், அது என்ன என்பதை விளக்கும் கடமை அவர்களுக்கு இருக்கிறது. இப்போது நீங்கள் கூறுங்கள் கடவுள் என்பது என்ன? பொருளா? கருத்தா? அல்லது இரண்டுமல்லாத வேறொன்றா? பதில் கூற முயற்சித்துப் பாருங்களேன்.

  45. அன்பு சகோ செங்கொடி.,
    உங்கள் மீதும் ஏகனின் சாந்தியும் சமதானமும் நிலவ
    ட்டுமாக!
    பகிர்ந்த பதிலுக்கு நன்றி.,! உங்களின் மையக்கருத்து இப்பேரண்டத்தில் இருப்பது அல்லது இயங்குவது ஒன்று பொருள் மற்றோன்று கருத்து., மிக சரியே., இதை நானும் ஏற்றுக்கொள்கிறேன்.,
    இப்போது என் கேள்வியே இத்துடன் பொருந்துங்கள்., நான் குறிப்பிட்ட கடவுள் என்பவர் அல்லது கடவுள் என்பது நாம் வரையறை செய்த பிரபஞ்ச எல்லைக்குள் இருப்பதாக கொண்டால் மட்டுமே நீங்கள் குறிப்பிட்ட மேற்கண்ட இரு வரையறைக்குள் வந்தாக வேண்டும் அப்படி இல்லையெனில் கடவுள் என்ற மூன்றாம் நிலைக்கு காரணம் தேவைப்படுகிறது அஃது கிடைக்காத பட்சத்தில் கடவுள் என்ற ஒன்று பூஜ்யாக்கப்படுகிறது.,

    ஆனால் கடவுள் என்பவரை அல்லது என்பதை இப்பிரஞ்சத்தில் உள்ளடக்க முடியா ஆனால் இப்பிரபஞ்சதை ஆளும் ஒரு நிலையாக கொள்ளும் போது எப்படி நீங்கள் குறிப்பிடும் பொருளியல் அல்லது கருத்தியல் கோட்பாட்டில் வரும். அத்தோடு மட்டுமில்லாமல் நீங்கள் குறிப்பிடும் மேற்கண்ட இரு நிலைகளில் ஒன்றின் கீழ் கடவுள் என்பவர் /என்பது வந்தால் சார்பு நிலையில் அது ஒரு தன்மையை பெறுகிறது என்பதோடு அதற்கான கட்டுப்பாடுகளும் வடிவிலக்கணமும் கிடைத்து விடுகிறது அப்படியிருந்தால் அதற்கு பெயர் கடவுளும் இல்லை.ஆக மனிதன் வரையறுத்த விதிகளில் சிக்காத
    கடவுளுக்கான தெரிதல்கள் இப்படி இருக்க

    நாத்திக /பரிணாம வாதிகள் நீங்களும் உட்பட
    1.மனிதன் ஏனைய அல்லது ஏதாவது ஒரு வழியில் உணரக்கூடிய வகையில் அமைந்திருக்க வேண்டும்.
    2. பிரபஞ்ச விதிகளுக்குள் வரையறை செய்யக்கூடிய கருத்தியல் கோட்பாட்டிற்குள் வடிவம் பெற்றிருக்க வேண்டும்
    3.இன்னும் சில காலங்களுக்கு முன் சென்றால்.,
    கண்களால் பார்த்து அறியப்பட வேண்டிய பொருளாக இருக்க வேண்டும்-

    கடவுள் என்பவர் மேற்கண்ட பண்பியலை சார்ந்திருக்கவேண்டும் என்ற அளவுகோலை உங்களுக்கு அளித்தது யார்? இந்த வரையறையே எங்கிருந்து எடுத்தீர்கள்?

    ஆய்வு ரீதியாக காணக்கிடைக்காத ஒரு பொருளுக்கு வேண்டுமானால் நீங்கள் குறிப்பிட்ட இரு சார்பு கோட்பாட்டில் ஒன்றை தாங்கி இல்லையென்றால் அப்பொருள் இல்லையென்றே அறிவார்ந்து முடிவு செய்யலாம் அதுதான் உண்மையும் கூட., ஆனால் இந்த இரண்டோ அல்லது இதுவல்லாத மூன்றாவது ஒரு மூலக்கூறு அல்லது நிலை இப்பிரபஞ்சத்தில் உருவாகி நாளை அறிவியலார் கண்டறிந்தாலும் அத்தகைய நிலை பண்புகளோடு கடவுள் என்பது பொருந்தி வராது சகோ.,

    சாத்தியக்கூறுகள் பொதுவான விதிப்படி எண்ணற்ற பதில்களைக் கொண்ட ஒரு செயலுக்கு, இல்லையென்பதை விட இருக்கிறது என்பதை உண்மைப்படுத்தவே அதிக நிரூபணம் வேண்டும். அதாவது ஒரு திட திரவ பொருளின் இருப்பை குறித்து அறிய அப்பொருளை கண்ணால் காணவில்லையென்று ஒருவர் பதில் தருவாரானால் அப்பொருள் அவர் முன் அல்லது அவரது கண்ணுக்கு தெரியாமல் இருப்பதே போதுமான சான்று ஆக கண்ணுக்கு தெரியவில்லை என்ற ஒரு சதவீகித வாதமே அவரது உண்மை நிலைக்கு போதுமானதாகும்., மாறாக கண்ணுக்கு தெரியாத அத்திட, திரவப்பொருள் உண்டென்று வாதிடும் ஒருவர் அதை நிருபிக்க 99 சதவீகித சான்று தர வேண்டும் .

    ஏனெனில் நாம் எல்லோரும் எந்த ஒரு திட திரவப்பொருளின் ஒழுங்குப்படுத்தப்பட்ட தன்மை மற்றும் வடிவிலக்கணம் குறித்து அறிவியல் ரீதியாக அறிந்து வைத்திருப்பதே அதற்கு காரணம். அதுப்போல இப்பிரபஞ்சத்தில் உள்ள ஒவ்வொரு பொருளுக்கான இலக்கணமும் மிக சரியாக தெளிவாக நம்மிடம் இருக்கிறது.ஆக எந்த ஒன்றை ஏற்பதையும் மறுப்பதையும் விஞ்ஞானரீதியில் உண்மைப்படுத்தலாம்.,
    நிற்க.,

    சரி வரைவிலக்கணத்திற்கு வருவோம் ., உங்கள் பார்வையில் இது ஓப்பிட்டு வாக்கியமாக எடுத்துக்கொண்டாலும்., பிரச்சனையில்லை
    ஆம் இல்லை என்ற இரண்டில் ஒரு பதிலால் மட்டுமே நூறு சதவீகித உண்மையாகும் ஒரு கேள்விக்கு சாத்தியக்கூறுகள் விதிப்படி மிக சரியாக இரண்டுக்கும் 50 சதவீகித வாய்ப்பு இருக்கிறது
    ஆக கடவுள் உண்டென்பதை நிருபிக்க இருக்கும் 50 சதவீகிதம் போலவே இல்லையென்பதை நிருபிக்கவும் 50 சதவீகிதம் வாய்ப்பிருக்கிறது.,ஆனால் அறிவியல் வரையறுத்த பண்பில் அடங்கும் பொருளுக்கே இவ்விதி அடங்கும் ,
    ஆனால் எந்த வழிகளிலும் அறிவியல் சாதனங்களால் சோதிக்க முடியாது அல்லது அறிவியல் வரையறுக்கும் வடிவிலக்கணங்களில் பொருந்தாது என்பதை மிக தெளிவாக விவரிக்கும் கடவுள் என்ற நிலைக்கு அதை அறிவியல் ரீதியாக நிருபிக்க ஒரு சதவீகிதம் கூட நிருபணம் தேவையில்லை.ஆனால் அறிவியல் வரையறுக்கும் பண்புகளில் பொருந்தாத நிலையில் உள்ள ஒன்றை விஞ்ஞான ரீதியில் இல்லையென்று நிரூபித்தாக இருந்தால் நூறு சதவீகித மூன்றாம் நிலை காரணத்தை தேட வேண்டும்.

    ஆக இங்கு கடவுள் இருப்பதை அறிவியல் ரீதியாக நிருபிக்க அவசியமில்லை., ஆனால் இல்லை என்பதை நிருபிக்க அறிவியலுக்கு வழியே இல்லை., ஆக குழப்பான வாதத்தை கையில் கொள்வது கடவுளை ஏற்பவர் அல்ல மறுப்பவரே

    ஆக நாம் மீண்டும் கேட்பது இதுதான்… கடவுள் இல்லையென்பதை வரையறுப்பதற்கான விஞ்ஞான ரீதியான குறீயிடுகள் என்ன என்பதும் அதை எங்கிருந்து பெற்றீர்கள் என்பதே?
    —-
    இஸ்லாமிய பதிவர்களை குறை கூறுவதை என்னால் ஏற்றுக்கொள்ள முடியாது., சகோ ஏனெனில் இஸ்லாத்தை விமர்சிக்கும் போது அவ்வாக்கியங்களை உணர்ச்சிப்பூர்வமாக அணுகும் போது ஒரு சில வசை சொற்கள் தோன்றுவது மனித இயல்பு தான்.இதை தவறென்று சொன்னாலும்
    அறிவுபூர்வமாக (?) இஸ்லாத்தை விமர்சிக்கும் நாத்திக பரிணாம வாதிகள் தன் முகம் மறைத்து போலி முகவரிகளுடன் அதுவும் நேர்மையற்று இஸ்லாமிய பெயர்களில் செய்யும் இத்தகைய இழிச்செயல்களை எந்த வகையில் சேர்ப்பீர்கள் ?- அதற்கு இங்கு மேலுள்ள பின்னூட்டங்களே மீண்டும் ஒருமுறை பாருங்கள் சகோதரரே.,
    ஏனைய ஆக்கங்கள் குறித்தும் பதில் தர முயற்சியுங்கள் .,
    ((சகோ இனி நான் முஸ்லிம் தொடர்பாக நீங்கள் இடும் கருத்துக்களை
    அங்கேயும் பதியவும் ஏனெனில் உரையாடும் கருப்பொருள் அங்கே தான் இருக்கிறது மேலும் உண்மையை எல்லோருக்கும் அறிய செய்தது போலவும் ஆகும்))

  46. நண்பர் குலாம்
    உங்கள் (பிடி)வாதங்கள் புல்லறிக்க வைக்கின்றன.இஸ்லாமிய இறைவன் பற்றி கருத்து கூறுபவர்கள் குரான் &ஹாதிது பற்றி வாயை திறப்பது இல்லை.

    முகமதுவிடம் ஜிப்ரீல் வருகிறார் ,பேசுகிறார் என்றால் அனைவருக்கும் தெரிய வேண்டுமல்லவா?

    சும்மா கட்வுள் பிரபஞ்சத்திற்கு அப்பற்பட்டவன்,விளங்க முடியாதவன் என்றெலாம் கதை விடாதீர்.ஒரு 6ஆம் நூற்றாணடு அரபிக்கு உள்ள புத்திதான் குரான் கூறும் கடவுளுக்கு உள்ளது.உங்கள் கார்ப‌ன் கூட்டாளி அல்லா கால்க்ஸிக்கு உள்ளே இருப்ப‌தை விள்க்கியும் உங்க‌ளுக்கு புரிய‌வில்லை எனில் .மார்க்க‌ மேதை இபின் ஷாகிரிட‌ம் விள்க்க‌ம் அறியுங்கள்.
    கடவுள் இருப்பு குறித்து நீங்கள் சொன்ன கருத்துக்கு எல்லாம் குரானில் ஆதாரம் காட்ட முடியுமா?

    பிரபஞ்சம் என்பது குரானின் படி வானம்?
    அது ஆல் இனால் அழகுராஜா மாதிரி அதே வார்த்தையை மேகம் என்பார்கள்

    மேகம்தான் ச‌ரியான‌ வார்த்தை

    சூரியன் பூமியை விட பெரியது என்று குரான் ஹதிது கொண்டு நிரூபிக்க முடியுமா?

    நட்சத்திரங்கள் சந்திரனை விட பெரியது என்று குரானில் காட்ட முடியுமா?

    த‌த்துவ‌ம் எல்லாம் இஸ்லாமுக்கு சம்பந்தம் இல்லாதது.ஹராம் இல்லை ஹலால் இதுதான்யா இஸ்லாம்!!

    ப‌திவுக்கு ச‌ம்ப‌ந்த‌மாக் ப‌ரிண‌ம‌ம் ப‌ற்ரி பேசவும்.இல்லை குரான் ஹ‌திது கூறும் ப‌டைப்பிய‌ல் பேச‌வும்

    போர் அடிக்காதீர்

  47. நண்பர் குலாம்
    /ஆக இங்கு கடவுள் இருப்பதை அறிவியல் ரீதியாக நிருபிக்க அவசியமில்லை., ஆனால் இல்லை என்பதை நிருபிக்க அறிவியலுக்கு வழியே இல்லை.,/
    கடவுள் தேவையா என்பதுதான் பிரச்சினை .இக்கணம் வரைக்கும் அல்லா முஸ்லிம்களில் மூளைக்குள் மட்டுமே இருக்கிறார்.

    இல்லையென்று நிரூபிக்க தேவையில்லை.காட்டு மிராண்டித்தனமான் பல்தாரமணம்,கல்லெறிந்து கொலவ்து அல்ல செய்ய சொல்கிறார் என்பதால் அல்லா என்பது முகமதுவின் கட்டுக் கதை என்று கூறுகிறோம்.
    மதம் என்ற பெயரில் அனைத்து ஆக்கிரமிப்புகளும்,ஜிஸ்யா வரி உட்பட நியாயப் படுத்தினால் பிற மதத்த்வரும் இதையே செய்ய மாட்டார்களா?.
    ஜிஸ்யா கொடுக்கும் வரை போரிடு என்று சொல்பவனை மனிதனாக் கூட ஏற்க முடியாது.இவர்தான் இஸ்லாமிய அல்லா
    குலாம் உங்கள் குரான் கூறும் அல்லாவை காப்பாற்ற மட்டும் வாதிடவும்.அலா பிற மதத்தவ்ரின் கடவுள் அல்ல.

  48. /ஆக நாம் மீண்டும் கேட்பது இதுதான்… கடவுள் இல்லையென்பதை வரையறுப்பதற்கான விஞ்ஞான ரீதியான குறீயிடுகள் என்ன என்பதும் அதை எங்கிருந்து பெற்றீர்கள் என்பதே?/

    யோசித்துதான் பெறுகிறோம்.

    முகமது யோசித்து வந்ததுதான் குரான். தன் இச்சைகளை நிறைவேற்ற அப்ப்டி சொன்னால் மதிக்க மாட்டார்கள் என்று அல்லா கூறியது என்று விட்ட புருடாதான் குரான் + இஸ்லாம்.

  49. நண்பர் குலாம்,
    சுற்றிவளைத்து நீங்கள் கூறியிருப்பவை வழக்கமானவை தான். கடவுள் என்ற ஒன்று பேரண்டத்திற்கு வெளியில் இருப்பதால் இந்த பேரண்டத்திற்கு உட்பட்ட விதிகள் கடவுளிடம் செல்லுபடியாகாது. இது குறித்து ஏற்கனவே ஒருமுறை இத்தளத்தில் விளக்கியிருக்கிறேன்.
    கடவுள் இப்பேரண்டத்தைப் படைத்துவிட்டு அதனுடன் தன்னுடைய வேலைகளை முடித்துக்கொண்டு இந்தப் பேரண்டத்திற்கு வெளியே ஒதுங்கிக் கொண்டு விட்டார் என்றால், அவர் பேரண்டத்திற்கு வெளியே இருந்துவிட்டுப் போகட்டும். அந்தக் கடவுளின் இருப்பு குறித்து எந்தப் பிரச்சனையும் எழாது. ஆனால் பிரச்சனை பேரண்டத்திற்கு உள்ளே செயல்படும் கடவுள் குறித்துத்தான். நீங்கள் அறிந்து வைத்திருக்கும் கடவுளுக்கு நாம் வாழும் இப்பேரண்டத்திற்கு வெளியே அலுவல் எதுவும் இருக்கிறதா? இருக்கக்கூடும் ஆனால் அது யாருக்கும் தெரியாது தெரிந்திருக்க வேண்டிய அவசியம் மனிதர்களுக்கு இல்லை என நீங்கள் கூறக் கூடும். ஆக அறியப்படும் கடவுள் மனிதனை, பூமியை மையப்படுத்தியது மட்டுமே.
    கடவுள் இடையறாது இப்பேரண்டத்தில் செயல்பட்டுக் கொண்டிருக்கிறார். ஒவ்வொரு துகளையும், ஒவ்வொரு அசைவையும் அவர் கண்காணித்துக் கொண்டிருக்கிறார். ஒவ்வொன்றுக்கும் இயங்குவதற்கான கட்டளைகளை பிறப்பித்துக் கொண்டிருக்கிறார். இப்பேரண்டத்தின் ஊடும் பாவுமாக எல்லாவிதங்களிலும் செயல்பட்டுக் கொண்டிருக்கும் கடவுளை; பேரண்டத்திற்கு வெளியே இருக்கிறார், எனவே இப்பேரண்ட விதிகள் அவருக்கு செல்லுபடியாகாது என்பது பொருத்தமாக இல்லையே.
    அவரே விதிகளைப் படைத்தவர் எனவே அந்த விதிகளுக்கு அவர் உட்பட வேண்டியதில்லை என்றாலும், பேரண்டத்திற்குள் அவர் படைத்த விதிகளைச் செயல்படுத்த சில அமைப்புகள் செயல்படுகின்றன, எதிராகவும் கூட. கடவுளுக்குத்தான் பேரண்ட விதிகள் பொருந்தாது என்றாலும், ஆதரவான, எதிரான அமைப்புகளும் (வானவர்கள், சைத்தான்கள்) பேரண்ட விதிகளுக்கு பொருந்தாதா?
    நீங்கள் கூறும் கடவுளின் இருப்பு, அது செயல்படுவதான தளங்கள், வரைவிலக்கணம், பேரண்டத்திற்கு வெளியிலிருக்கும் தன்மை ஆகிய இவை அனைத்துமே கற்பனையானவை. இவைகளை மெய்ப்படுத்துவதற்கான வாய்ப்புகள் சிறிதும் இல்லை என்பதால் தான் மதவாதிகள் பேரண்டத்திற்கு வெளியே, விதிகள் பொருந்தாது என்பன போன்ற புனைவுகளை பயன்படுத்துகிறார்கள்.
    கடவுள் என்பது விதிகளுக்கு உட்பட்டாக வேண்டும் என்பதை மறுப்பாளர்களுக்கு அளித்தது யார்? பெற்றது எங்கிருந்து? எனும் உங்கள் கேள்விக்கு வருவோம். இது வெகு சுலபமானது தான். எந்த ஒன்றையும் ஏதாவது ஒன்றின் அடிப்படையில் தான் அறிந்துகொள்ள முடியும், புரிந்துகொள்ள முடியும். மனிதனிடம் இருக்கும் ஒரே அடிப்படை பேரண்ட விதிகள் தான். அந்த விதிகளுக்கு உட்படாத எதுவும் கற்பனையானது, நம்பிக்கை அடிப்படையிலானது என்பதாகத்தான் இருக்க முடியும். நீங்கள் குறிப்பிடும் அதே வியாக்கியானங்களுடன் இரண்டாவது அல்லா என்றொரு கருத்து இங்கு உலவுகிறது என்று கொள்வோம். இப்போது முதல் அல்லா இரண்டாவது அல்லா இரண்டில் எது சரியானது என்று தீர்க்க வேண்டிய பிரச்சனை ஏற்படும். இதை எந்த அடிப்படையில் தீர்ப்பது? நம்பிக்கை மட்டுமே போதும், எந்த விதிகளுக்கும் உட்படாது என்றால் இரண்டையுமே ஏற்க வேண்டியது வரும். ஆக ஏதேனும் ஓர் அளவீடுகளுக்கு வந்தாக வேண்டும். மனிதனுக்கு தெரிந்த ஒரே அளவீடு பேரண்ட விதிகள் தாம். அல்லது நீங்கள் கூட ஒரு அடிப்படையைக் கூறலாம். ஆனால் நம்பிக்கை மட்டும் போதாது என்பதை நீங்கள் உணர வேண்டும்.
    கடவுள் இருப்பு அல்லது மறுப்பு எனும் விசயத்தில் எந்த விதிகளுக்கும் உட்பட்டாகவேண்டிய தேவை கடவுளுக்கு இல்லை என்று கூறும் நீங்கள், அதனாலேயே கடவுளை அறிவியல் ரீதியாக நிரூபிக்க வேண்டிய அவசியமில்லை என்றும் கூறுகிறீர்கள். என்றால், எந்த அடிப்படையில் நீங்கள் கடவுள் மறுப்பை தவறு என்று கூற முடியும்? ஏனென்றால் முழுக்க முழுக்க நம்பிக்கை சார்ந்த ஒரு விசயத்தில் அறுதி முடிவு என்று எதையும் கூறமுடியாது. இந்த விசயத்தில் முரண்பாடான எதிரும் புதிருமான ஒரு நிலையை நீங்கள் எடுக்கிறீகள். கடவுள் எந்த விதிகளுக்கும் உட்பட வேண்டிய அவசியமில்லை, அதனால் அறிவியல் ரீதியாக நிரூபிக்க வேண்டிய அவசியமில்லை என்றால், அதை தோராயத்தன்மை கொண்டதாக, ஒரு நிலைபாடாக மட்டுமே கொள்ள முடியும். ஆனால் நீங்கள் கடவுள் என்பது உறுதியாக நிலவிக் கொண்டிருக்கும் ஒன்று என்று கூறுகிறீர்கள். உறுதியானது என்று நீங்கள் கூறவேண்டுமென்றாலே அங்கு வேறு வாய்ப்புகளின்றி நிரூபணம் இருந்தாக வேண்டும். கடவுள் இருப்பது உறுதி என்றால் ஏதாவது ஒரு வகையில் நிரூபணம் வேண்டும். நிரூபணம் இல்லை என்றால் அது தோராயத்தன்மை உடையதாக இருந்தாக வேண்டும். இரண்டில் எது சரி?
    ஆனால் கடவுள் மறுப்புக்கு இந்த நிலை இல்லை. நாளைய அறிவியல் ஆய்வுகள் கடவுள் இருக்கிறது என்பதை நிரூபித்தால் யாராலும் அதை மறுக்க முடியாது. அதேநேரம் இன்றைய நிலையில் ஆதாரம் எதுவும் இல்லை என்பதால் நம்பிக்கையை மட்டுமே அடிப்படையாகக் கொண்டு கடவுளை ஏற்கவும் முடியாது. எனவே இதில் கடவுள் இருப்பை விட கடவுள் மறுப்பே தர்க்க ரீதியில் சரியான வழியாக இருக்கிறது.

    பின்குறிப்பு: இஸ்லாமியர்கள் குறித்து நான் குறை கூறவில்லை யதார்த்தத்தைக் கூறுகிறேன். இந்தத் தளம் முழுவதிலும் விரவிக்கிடக்கும் பின்னூட்டங்களைக் கண்ணுற்றால், அது உங்களுக்கு புரியக் கூடும்

  50. ஏக்க இறைவனின் திருபெயரால்

    மூஃமின்களுக்காகவே பல பதிவுகளை எழுதியிருந்தாலும் தாவாப்பணிக்காக காஃபிர்களை இஸ்லாமின் பக்கம் திருப்ப பத்வாக்கள் எப்படி காஃபிர்களுக்கும் மனம் மகிழக்கூடியவையாக இருக்கின்றன என்பதை விவரித்து ஒரு பதிவு எழுதியுள்ளேன்
    உங்கள் கருத்துக்களை பகிர்ந்துகொள்ளுங்கள்
    காபிர்கள் மனம் மகிழ பத்வாக்கள் பத்து.

    அல்ஹம்துலில்லாஹ்

  51. அன்பு சகோ செங்கொடி
    உங்கள் மீதும் ஏகனின் சாந்தியும் சமாதானமும் நிலவட்டுமாக
    //சுற்றிவளைத்து நீங்கள் கூறியிருப்பவை வழக்கமானவை தான்.//
    இது தான் என் பதிலும்.,

    //கடவுளுக்குத்தான் பேரண்ட விதிகள் பொருந்தாது என்றாலும், ஆதரவான, எதிரான அமைப்புகளும் (வானவர்கள், சைத்தான்கள்) பேரண்ட விதிகளுக்கு பொருந்தாதா?//
    நீங்களும் வழக்கானவர்களைப்போல இஸ்லாத்தை தவறாக புரிந்து வைத்தீருக்கிறீர்கள். அதற்கு மேலுள்ள ஒரு வரியை சான்று

    நான் சுற்றி வளைத்து பேசவில்லை. ஏனைய மத கோட்பாடுகளின் அடிப்படை தவறானது என்று நானே ஒப்புக்கொள்கிறேன்., உங்களை பொறுத்த வரை இஸ்லாமும் அதுக்கூறும் கோட்பாடுகளும் தவறு. ஆக இனி இஸ்லாத்தை குறித்தும் அதுக்கூறும் கடவுளை விவாதிப்பதில் எத்தகைய பலனும் ஏற்படபோதில்லை. பொதுவாக நாத்திகர்கள் என்று வாதிடக்கூடியவர்கள் பலரை பார்த்தாகி விட்டது., இஸ்லாம்-பெண்ணியம்-பர்தா-ஆணாதிக்கம்- நபிகளாரின் திருமணம் ஆகியவற்றை விமர்சித்தே வண்டி ஓட்டிக்கொண்டிருக்கிறார்கள் யாரும் நாத்திகம் எனும் கொள்கை உலக மக்கள் யாவருக்கும் பின்பற்ற உகந்த சிந்தனை என்பதை முன்னிருத்தி விவாதிப்பதில்லை., அதை தருமி, கும்மி,வால்பையன், தமிழன் தொட்டு சார்வாகன் வரை கேட்டாகிவிட்டது. மீண்டும் இஸ்லாத்தை முன்னிருத்தி மட்டுமே பக்கம் பக்கமான பதில் ,நீங்களும் அப்படி இருக்க மாட்டீர்கள் என்ற எண்ணத்தில் அதே கேள்விகள் இங்கேயும்- நீங்கள் கூறுங்கள் இனி.,
    (1) கடவுள் எதிர்ப்பை தாண்டி நாத்திக அடிப்படை கொள்கை என்ன?
    (2) எதை அடிப்படையாக வைத்து நம் வாழ்வை மேற்கொள்வது
    (3) கடவுள் வேண்டா சமுகத்தில் உலக மக்கள் அனைவருக்கும் பொதுவான மற்றும் நியாமான நீதி செலுத்த வேண்டும் முடியுமா?
    இன்னும் விரிவு வேண்டினால் நான் முஸ்லிம் தளம் பாருங்கள்
    மேற்குறிப்பிடப்பட்ட மூன்று கேள்விகளை தாண்டி விளக்கமென வேறு எதையாவது மீண்டும் கொண்டு வரவேண்டாம் (பதிலிட்டதும் தெரியப்படுத்துங்கள்)
    -இறை நாடினால் இனியும் சந்திப்போம்

  52. நண்பர் குலாம்

    இஸ்லாம் குறித்து யார் என்ன விமர்சனம் செய்தாலும், அவர்கள் இஸ்லாத்தை தவறாக விளங்கிக் கொண்டு செய்கிறார்கள் என்பது பொதுவான பதில். நீங்களும் அவ்வாறே குறிப்பிட்டிருக்கிறீகள்.

    இறைவனை நிரூபிக்க அறிவியல் உதவாது. தர்க்கமே உதவும் என நீங்கள் எண்ணியததால் தான் நான் தர்க்க ரீதியில் பதில் கூறியிருந்தேன். அது தவறு என்றால் எப்படி தவறு என்பதை விளக்கலாமே. மாறாக விட்டுவிட்டு வேறு கேள்விகளுக்கு நகர்ந்து விட்டீர்கள்.

    கடவுள் எதிர்ப்பை தாண்டி நாத்திக அடிப்படை கொள்கை என்ன?

    ஒன்றுமில்லை. நாத்திகம் என்பது ஆத்திகத்திற்கு எதிர்ப்பதம். கடவுள் மறுப்பு மட்டுமே அதன் சாரம். நாத்திகம் முழுமையான ஒன்றல்ல. நாத்திகர்களுக்கான சமூகப் பார்வை ஒரே போல் இருப்பதில்லை. சமயத்தில் சமூகப் பார்வையே இருப்பதில்லை. பெரியார் சமூக ஒடுக்குமுறைகளுக்கு எதிராக பார்ப்பனிய எதிர்ப்பை சமூகப் பார்வையாக கொண்டிருந்தார். கம்யூனிஸ்டுகளைப் பொருத்தவரை நாத்திகம் ஒரு விசயமே அல்ல. சமூக ஏற்றத்தாழ்வுகள் நீடித்திருப்பதுவரை மதங்களும் நீடித்திருக்கும். சமூக ஏற்றத்தாழ்வுகள் நீக்கப்படும் போது கடவுள் நம்பிக்கையும் புண்ணின் மீதிருக்கும் காய்ந்த பொருக்கைப் போல் உதிர்ந்துவிடும். கம்யூனிஸ்டுகளின் சமூகப் பார்வை என்ன? என்று கேட்கமாட்டீர்கள் என எதிர்பார்க்கிறேன்.

    எதை அடிப்படையாக வைத்து நம் வாழ்வை மேற்கொள்வது?

    வரலாற்றியல் பொருள் முதல் வாதம், இயங்கியல் பொருள் முதல் வாதம்.

    கடவுள் வேண்டா சமுகத்தில் உலக மக்கள் அனைவருக்கும் பொதுவான மற்றும் நியாமான நீதி செலுத்த வேண்டும் முடியுமா?

    முடியும். முடிந்தால் கம்யூனிசம் குறித்து படித்துப் பாருங்கள். அனைவருக்கும் நியாயமான நீதி செலுத்த முடியும். ஆனால் அனைவருக்கும் பொதுவான நீதி(!)? அப்படி ஒன்று கிடையாது. வர்க்கங்களாய் பிரிந்து கிடக்கும் மக்களிடம் அனைவருக்கும் ஒரே பொதுவான நீதி என்று சொல்வதே அநீதி.

    உங்கள் கேள்விகளுக்கு அடிப்படையான பதிலைக் கூறியிருக்கிறேன். உங்கள் பதிவுகளைப் படித்து விரிவாக பதிலளிக்க வேண்டுமென்றால் சற்று காத்திருக்க நேரிடும். அவசரம் என்றால் கேள்வி பதில் பகுதியில் உங்கள் கேள்விகளை ஒவ்வொன்றாக பதிவு செய்யுங்கள்.

  53. உங்கள் மீதும் ஏகனின் சாந்தியும் சமாதானமும் நிலவட்டுமாக!
    அன்பு சகோ செங்கொடி
    பதில் பகிர்வுக்கு நன்றி!
    இஸ்லாத்தை விமர்சிக்கும் ஏனையோரைப்போல நீங்களும் அதுக்குறித்து முழுதாக விளங்கிக்கொள்ளவில்லை என்பது உங்களின் ஆக்கங்களிலும் தெளிவாக தெரிந்தாலே அவ்வார்த்தை காரணம் சொல்கிறேன்.எங்கே என கேட்க மாட்டீர்கள் என நினைக்கிறேன்., ஏனெனில் உங்களின் சில தவறான புரிதலுக்கு நான் முஸ்லிம் தளத்திலும் சில விளக்கங்கள் இருக்கின்றன
    எனினும் புரிதலில் ஏற்பட்ட தவறு குறித்து உங்கள் பார்வைக்கு, என்னிடம் இஸ்லாத்தை குறித்த விவாதிக்கும் நாத்திகர் முதலில் தும்மல் ஏற்படுவது அறிவியல் பூர்வமானது அதை ஏன் இறைவனோடு தொடர்பு படுத்துகிறீர்கள் என்றார், அடுத்தவரோ எல்லாம் சரிதான் குர்-ஆன் மூலமொழி இந்தியில் ஏன் இருக்கிறது என்றார்,, இப்படி பல.,
    நீங்களும் பாருங்கள்., கடவுள் குறித்த அறிவியல் நிருபணம் இரு தரப்பிலும் சாத்தியமில்லை என்று தெளிவானவுடன் அடுத்து சைத்தான், மலக்குகள் குறித்து தாவி விட்டீர்கள்., அதுவும் அறிவியல் நிருபணம் வேண்டும் என…
    சகோ எந்த செய்கை குறித்தும் ஆராய அச்செய்கை விளக்கப்பட்டிருக்கும் விதம் குறித்து முதலில் அறிய வேண்டும். பின்பே நாம் தொடுக்கும் வினாக்களுக்கு அச்செய்கை என்ன பதில் வைத்திருக்கிறது என ஓப்பு நோக்கவேண்டும். ஆனால் மாறாக இஸ்லாத்தை விமர்சிக்கும் (உங்களையும் சேர்த்து) நாத்திகர்கள் எந்த ஒன்றின் மூலத்தையும் ஆராயாமல் தானே ஒரு கேள்வி எழுப்பி அதற்கான பதில்களை தானே தெரிவு செய்து இப்படி தான் இருக்கும் அல்லது இப்படி தான் வேண்டும் என எதிர்பார்த்தால் அதுக்குறித்து எப்படி நடுநிலையோடு வாதிக்க முடியும்?

    உங்களின் மலக்குகள் குறித்த வினாக்களும் இந்த வகை சார்ந்ததே., இதற்கான தெரிதலும் அல்ஹம்துலில்லாஹ் ஏற்கனவே பதிவிட்டு இருக்கிறேன்.பார்வையிடுங்கள் சகோ.,

    அடுத்து நான் விடுத்த மூன்று கேள்விகளுக்கு பதில் தந்திருக்கிறீர்கள் ஆனால் நான் கேட்டது தர்க்க்ரீதியான வழிமுறை
    நாத்திகம் குறித்த கொள்கை பூஜயமானது என்பதை ஒப்புகொண்டதற்கு நன்றி எனினும், எந்த ஒரு கொள்கை கோட்பாடுகளையும் விமர்சித்து அந்த கொள்கை நடைமுறை வாழ்க்கைக்கு ஒத்துவராது – பொருந்தாது என வாதிட்டால் அதற்கு மாற்றமாக ஒரு கொள்கையே அதற்கு பகரமாக கொண்டு வருவதோடு அக்கொள்கையில் சாத்தியமில்லா தன்மயை புதிதாய் கொணரும் கொள்கையில் நிறுவ வேண்டும். அதனடிப்படையில் இஸ்லாம் மனித வாழ்வியலுக்கு பொருந்தாது என்றால் அதற்கு எதிராக உருவாகும் எத்தகைய கொள்கையாக இருந்தாலும் அது கருத்தியல் கொண்ட நாத்திகமாகவோ- அல்லது இயக்கம் சார்ந்த கம்யூனிஷமாவோ இருக்கட்டும்., இஸ்லாத்தை விட உயரிய சிந்தனையே மனித சமுகத்திற்கு கொடுக்க க்கூடிய தாக இருக்க வேண்டும்., ஆனால் மேற்கண்ட இரு கொள்கைகளால் கடவுளுக்கு செய்யவேண்டிய வணக்க வழிபாடுகள் மற்றும் அது கொணரும் மறுமை சார்ந்த நம்பிக்கைகளை நம்புவது போன்றவை தேவயற்ற காலவிரயம் என்று கூறி மனித சமுகங்களில் மறைவான வற்றின் மீதான தாக்கத்தை குறைக்கலாம் ஒழிய நூறு சதவீகித அனைத்து நிலைகளிலும் நீதமான நீதி வழங்குவது என்ற நடைமுறை சாத்தியக்கூறுகள் ஏற்படுத்துவதில் எள்ளவும் மாற்றத்தை கொண்டு வர முடியாது என்பதை விட சாத்தியமே இல்லை
    உதாரணமாக இஸ்லாம் மனிதர்கள் செய்யும் நன்மை/தீமைக்கேற்ப நீதி செலுத்த சொல்கிறது, அப்படியும் அவர்கள் மேற்கண்ட அச்செய்கைகளுக்கு உரிய நீதி சமுகத்தால் செலுத்த படவில்லையென்றால் அதற்கான நீதி அம்மக்களுக்கு மறுமையில் துளியளவும் அநியாயமின்றி வழங்கப்படும் என்கிறது.
    ஆக இக்கருத்துக்கு மாற்றமான கொள்கையாக இருந்தால் என்ன செய்ய வேண்டும்??? நூறு சதவீகித நீதமான தீர்ப்பை இங்கே வழங்குவதற்கான சாத்தியக்கூறுகளை உருவாக்க வேண்டும் !
    முடியுமா..? இது தான் என் மையக்கேள்வி .
    //அனைவருக்கும் பொதுவான நீதி(!)? அப்படி ஒன்று கிடையாது.// குட்..இதுதான் இங்கு பிரச்சனை.. மேற்சொன்னது உண்மையானால் ஏன் முடியாது அப்படியென்றால்,அனைத்திற்கும் தீர்வு காணுவது மனித உருவாக்க சட்டங்களால் முடியாது என்பதை ஓப்புக்கொள்கீறீர்களா..?
    இதுக்குறித்து விளக்கமாக கீழ்கண்ட ஆக்கத்தில் விரிவாக சொல்லி இருக்கிறேன்.
    http://iraiadimai.blogspot.com/2010/08/blog-post_15.html

    பார்வையிடுங்கள் அவசரமல்ல.. பொறுமையாக எனக்கு தேவை பதில் அல்ல தர்க்கரீதியான உண்மை முயற்சியுங்களேன்.,
    -இறை நாடினால் இனியும் சந்திப்போம்

  54. குலாம்,
    தோழர் குறிப்பிட்டுள்ளதை நீங்கள் தவறாக புரிந்து கொண்டிருக்கிறீர்கள்.. மனித சமூகம் வர்க்கங்களாக பிரிந்திருப்பதை குரான் ஆதரிக்கிறது. ஆனால் கம்யூனிசம் வர்க்கமற்ற சமூகத்தை வலியுறுத்துகிறது. சமூகம் வர்க்கங்களாக பிரிந்திருக்கும் வரையில் தான் பொது நீதி என்பது சாத்தியமில்லை. ஆனால் வர்க்கமற்ற சமூகத்தில் பொது நீதி என்பது சாத்தியம். எனவே அல்லா நீதிமான் என்று குரானில் புகழப்படுவது, இவ்வுலகில் ஒரு மன்னனை போற்றிப் புகழும் ஒரு புலவனின் உவமைக்கு ஒப்பானதைத் தவிர வேறில்லை.

    உடனடியாக நீங்கள் உணர்ச்சிவசப்படலாம், கம்யூனிசத்தின் மீது வீசப்பட்ட அவதூறுகளை சேகரித்து மீண்டும் வீச முற்படலாம். கம்யூனிசம் என்பது கற்பனை, ஒரு நாட்டில் கூட உயிர் வாழமுடியாமல் தோற்றுப்போன ஒரு சித்தாந்தம், மார்க்ஸ் குடிகரன், ஸ்டாலின் கொடுங்கோலன், மாவோ கொலைகாரன் என வசைபாடல்களுக்கு மீண்டும் உயிர் கொடுக்க முயலலாம். அதுவல்ல பிரச்சினை பொது நீதிக்கு நெருக்கமானது இஸ்லாமிய கொள்கையா? அல்லது கம்யூனிசக் கொள்கையா? என்பதுதான்.

    அறிவியலுக்கேற்ப அடைப்புக் குறிக்குள் வார்த்தைகளையும், விளக்கங்களையும் மாற்றிக்கொள்ளும் சகோதரர்களே, இஸ்லாமியக் கொள்கைகளை வர்க்கம் கடந்து படித்துப் பாருங்கள் குரானின் பித்தலாட்டம் உங்களுக்கு புலப்படும்

  55. உங்களின் அதிகமான கருத்துக்களில் எனக்கு உடன்பாடு இல்லை என்ற போதிலும், கீழே கொடுக்கப்பட்ட சில விசயங்களை விளக்கியாக வேண்டும்.

    //அறிவியலுக்கேற்ப அடைப்புக் குறிக்குள் வார்த்தைகளையும், விளக்கங்களையும் மாற்றிக்கொள்ளும் சகோதரர்களே, இஸ்லாமியக் கொள்கைகளை வர்க்கம் கடந்து படித்துப் பாருங்கள் குரானின் பித்தலாட்டம் உங்களுக்கு புலப்படும்//

    இதே கருத்தை பலர் வைக்கின்றனர். அப்படி எடுத்து வைக்கும் தோழர்கள் சரியான அரபி பதத்தை கொடுத்து அதற்கு இதுதான் அர்த்தம் என்று ஏன் கூறமுடியவில்லை. அரபியிலும் dictionary இருக்குதல்லவா, அப்படி கூறினால் தங்களுடையது பொய் பிரச்சாரம் என்பது வெட்ட வெளிச்சமாகி விடும் என்பதாலா?

    உண்மையில் நாத்திகமோ அல்லது கமுநிசமோ நடைமுறை பிரச்சனைகளுக்கு தீர்வே இல்லை. தனி மனித ஒழுக்கத்திற்கு என்ன நடவடிக்கை உள்ளது உங்களிடத்தில், உதாரணமாக பதிவுலகில் கூட இதை நீங்கள் கண்கூடாக பார்க்கலாம், நாத்திக கமுநிஷ பதிவர்களின் வார்த்தைகளில் உள்ள நாகரீகமே(!?) இதற்கு சாட்சி.

  56. முதலில், சகோதரர்கள் வர்க்கங்களைப் பற்றி தெரிந்துகொள்ளுமாய் தாழ்மையுடன் கேட்டுக்கொள்கிறேன்

  57. நண்பர் குலாம்,

    நான் இஸ்லாம் குறித்து தவறாக புரிந்து கொண்டு எழுதுகிறேன் என்றால், அதில் என்ன தவறு இருக்கிறது? அது எப்படி தவறாக இருக்கிறது? என்பதை சுட்டிக்காட்டி விளக்கும் கடமை உங்களுக்கு உண்டு. அதை முதலில் செய்யுங்கள்.

    நாம் இந்த விவாதத்தை கடவுளுக்கான வரைவிலக்கணம் குறித்த உங்கள் கூற்றுகளுடன் தொடங்கினோம். கடவுள் என்பது கருத்தா பொருளா அல்லது இரண்டுமல்லாத வேறொன்றா என்று கேள்வி எழுப்பப்பட்டது. இந்த அளவுகோல்களில் எல்லாம் கடவுள் சிக்க மாட்டார். அவர் பேரண்டத்திற்கு வெளியில் இருக்கிறார் என்றீர்கள். ஒரு வாதத்திற்காக கடவுள் வெளியில் இருக்கிறார் என்றே வைத்துக் கொண்டாலும், அவரின் செயல்பாடுகள், அலுவல்கள் அனைத்தும் மனிதனை மையப்படுத்தியே, பேரண்டத்திற்கு உள்ளேயே இருக்கிறது. உங்கள் விருப்பப்படியே அறிவியலிலிருந்து கடவுளைக் கழற்றி விட்டாலும், கடவுளுக்கு உதவும் எதிர்க்கும் அமைப்புகளும் அறிவியலில் அகப்படவில்லையே. மட்டுமல்லாது தர்க்க ரீதியிலும் கடவுள் இருப்பை விட கடவுள் மறுப்பே சிறப்பாக இருக்கிறது என்று காட்டினேன். இதை மறுத்து நீங்கள் கடவுள் இருப்பே சரியானது என்பதை விளக்கியிருக்க வேண்டும். அதை நீங்கள் செய்யவில்லை

    \\ எந்த செய்கை குறித்தும் ஆராய அச்செய்கை விளக்கப்பட்டிருக்கும் விதம் குறித்து முதலில் அறிய வேண்டும். பின்பே நாம் தொடுக்கும் வினாக்களுக்கு அச்செய்கை என்ன பதில் வைத்திருக்கிறது என ஓப்பு நோக்கவேண்டும். ஆனால் மாறாக இஸ்லாத்தை விமர்சிக்கும் (உங்களையும் சேர்த்து) நாத்திகர்கள் எந்த ஒன்றின் மூலத்தையும் ஆராயாமல் தானே ஒரு கேள்வி எழுப்பி அதற்கான பதில்களை தானே தெரிவு செய்து இப்படி தான் இருக்கும் அல்லது இப்படி தான் வேண்டும் என எதிர்பார்த்தால் அதுக்குறித்து எப்படி நடுநிலையோடு வாதிக்க முடியும்?// இப்போது இப்படி கூறியிருக்கிறீகள். அல்ல. நான் மேலெழுந்தவாரியாக எதையும் பார்ப்பதில்லை. இந்தத் தன்மையில் தான் என்னுடைய பதில்கள் இருக்கின்றன என்றால் அதை சுட்டிக்காட்டுங்கள். மாறாக இப்படி பொதுவாக கூறிவிட்டு நகர்ந்துவிடாதீர்கள்.

    பிறகு மூன்று நாத்திகம் குறித்த கேள்விகளை எழுப்பியிருந்தீர்கள். அதற்கு பதிலளித்திருந்தேன். கடவுள் எதிர்ப்பைத் தாண்டி நாத்திகத்தின் அடிப்படை என்ன? என்ற கேள்விக்கு கடவுள் மறுப்பைத் தாண்டி அதில் வேறு ஒன்றுமில்லை என்று குறிப்பிட்டிருந்தேன். இப்போது நீங்கள் எழுதியிருக்கிறீகள், \\ நாத்திகம் குறித்த கொள்கை பூஜயமானது என்பதை ஒப்புகொண்டதற்கு நன்றி// அதாவது கடவுள் மறுப்புக்கு வெளியே நாத்திகத்தில் ஒன்றுமில்லை என்பதற்கும் நாத்திகக் கொள்கை பூஜ்யம் என்பதற்கும் நிறைய வித்தியாசம் இருக்கிறது. சுருக்கமாகச் சொன்னால் நான் கூறியதை உங்களுக்கு சாதகமாக வளைக்கிறீர்கள். இது சரியானதல்ல.

    கம்யூனிசம் குறித்த குறைந்தபட்ச அடிப்படை புரிதலாவது உங்களுக்கு இருக்க வேண்டும் என எதிர்பார்க்கிறேன். இந்த உலகிலிருக்கும் அனைத்து கொள்கைகள், இசங்கள், மதங்கள் அனைத்திற்கும் மாற்றாக கம்யூனிசம் பொதுவுடமை சித்தாந்தத்தை கொண்டிருக்கிறது. உலகம் எப்படி இருக்கிறது, எப்படி இயங்குகிறது, எப்படி அது இயங்க வேண்டும், எந்த திசைவழியில் அது மாறிச்செல்ல வேண்டும், எப்போது உலக மக்களுக்கு சமத்துவ சமவாய்ப்பு, வசதிகள் கிட்டும் என கம்யூனிசம் மிக விரிவாக பேசுகிறது. கம்யூனிசம் என்பதை நாத்திகம் என்பதாக புரிந்து கொள்ளாதீர்கள். கம்யூனிசத்தின் வெகு சொற்பமான ஒரு பகுதி தான் நாத்திகம். இஸ்லாத்தை தவறாக புரிந்து கொண்டிருக்கிறீகள் என யாரையும் சுட்டுவதற்கு முன்னால், நீங்கள் சுட்டுவது குறித்து அறிந்து கொள்ளும் கடமை உங்களுக்கு இருக்கிறது.

    மனிதச் சட்டம், இறைச் சட்டம் என்றெல்லாம் கூறுகிறீகள். இவைகள் குறித்து பேசுவதற்கு முன்னால் அரசு என்றால் என்ன? சட்டம் என்பதன் பொருள் என்ன? சட்டங்களின் தேவை எப்போது எழுகிறது? என்பவை குறித்து எப்போதாவது சிந்தித்திருக்கிறீகளா? மனித இனம் வர்க்கங்களாக பிரிவதற்கு முன்பு மையப்படுத்தப்பட்ட அரசோ, சட்டங்களோ அவசியமில்லாமல் இருந்தது. இதை உள்வாங்கினால் தான் மனிதச் சட்டங்களுக்கு இறைச் சட்டங்களாக நீங்கள் கூறுவதற்கும் இடையில் என்ன வேறுபாடு என்பது துலக்கமாகும். நீங்கள் வினா தொடுத்திருப்பது போல் எல்லோருக்கும் நியாயமான நீதியை இங்கேயே வழங்க முடியும் என்று தான் கம்யூனிசம் கூறிக் கொண்டிருக்கிறது. அது என்ன சொல்கிறது என்பதை கொஞ்சம் படித்துத்தான் பாருங்களேன்.

    அடுத்து வேறு கட்டுரையின் சுட்டியை தந்து பதில் கூறச் சொல்கிறீர்கள். சொல்கிறேன். அதற்கு முன்னால், இதுவரை நாம் பேசியவற்றை கொஞ்சம் ஒழுங்குபடுத்திக் கொள்ளலாமா?

    அறிவியல் ரீதியாக கடவுளின் இருப்பையோ, மறுப்பையோ நிரூபித்துவிட முடியாது என்கிறீகள். அவ்வாறல்ல, கடவுள் மறுப்பை அறிவியல் ரீதியாக நிரூபித்து விடமுடியும். ஆனால் அதை கடவுளை நம்புபவர்கள் ஏற்றுக் கொள்வதில்லை. ஏனென்றால் அது ஐயந்திரிபற மெய்ப்பிக்கப்பட அறிவியல் இன்னும் பயணப்பட வேண்டியதிருக்கிறது. அதேநேரம் தன் நம்பிக்கையை மீளாய்வு செய்வதற்கு ஆயத்தமாக இருக்கும் யாருக்கும் இதுவரையிலான அறிவியல் பாதைகளிலேயே கடவுள் மறுப்புக்கான தடங்களை கண்டடைய முடியும். இதனால் தான் நீங்கள் தர்க்க ரீதியாக கேள்வியெழுப்பினீர்கள். தர்க்க ரீதியாகவும் கடவுள் மறுப்பே சரியானது என்பதையும் நான் விளக்கியிருக்கிறேன். அவைகளுக்கு நீங்கள் பதிலளிக்க வேண்டும். இன்னும் கடவுள் இருப்பு என்பதையும் அறுதியான முடிவாக நம்பிக்கையாளர்களால் கூறமுடியாது என்பதையும் சுட்டியிருக்கிறேன், அதற்கும் நீங்கள் பதிலளிக்க வேண்டும். அப்போது தான் நாம் தொடர்ச்சியாக விவாதிப்பதற்கு வசதியாக இருக்கும்.

  58. அன்பு சகோ செங்கொடி.,
    உங்கள் மீதும் ஏகனின் சாந்தியும் சமாதானமும் நிலவட்டுமாக
    யார் திசை திருப்ப முயற்சிப்பது., – மீண்டும் அதே குற்றச்சாட்டு
    முதலில் நமக்குள் நடைப்பெற்ற கடவுள் இருப்பு குறித்த உரையாடலில்.,
    நான் கூறிய வாதம்
    //ஆனால் கடவுள் என்பவரை அல்லது என்பதை இப்பிரஞ்சத்தில் உள்ளடக்க முடியா ஆனால் இப்பிரபஞ்சதை ஆளும் ஒரு நிலையாக கொள்ளும் போது //
    என்றே கூறினேன். மாறாக பேரண்டம் தாண்டி சூன்யத்தில் நிறைந்திருக்கும் மூன்றாம் பொருளாக கூறவில்லை ஆனால் நீங்களோ
    //இந்த அளவுகோல்களில் எல்லாம் கடவுள் சிக்க மாட்டார். அவர் பேரண்டத்திற்கு வெளியில் இருக்கிறார் என்றீர்கள்.//
    என்ற கடவுளின் இருப்பு மூன்றாம் நிலையில் இருப்பதாக உணர்த்த முயற்சிக்கி
    றீர்கள்.மேலும் அவர் செய்கை இப்பேரண்டத்தின் விதிகளில் தொடர்புடையதாக மீண்டும் நிறுவ முயன்று போலி காரணம் தேடுகிறீர்கள். நான் தெளிவாக முதல் பின்னூட்ட்த்திலே இப்படி
    //ஆனால் இந்த இரண்டோ அல்லது இதுவல்லாத மூன்றாவது ஒரு மூலக்கூறு அல்லது நிலை இப்பிரபஞ்சத்தில் உருவாகி நாளை அறிவியலார் கண்டறிந்தாலும் அத்தகைய நிலை பண்புகளோடு கடவுள் என்பது பொருந்தி வராது சகோ.,//
    சுற்றி வளைத்து பேசுவது நானா நீங்களா???

    அதுவுமில்லாமல் கடவுள் குறித்த நம்முடைய கருத்து பரிமாற்றங்கள் இன்னும் முடிவுயுறா நிலையில்
    //நீங்கள் கூறும் கடவுளின் இருப்பு, அது செயல்படுவதான தளங்கள், வரைவிலக்கணம், பேரண்டத்திற்கு வெளியிலிருக்கும் தன்மை ஆகிய இவை அனைத்துமே கற்பனையானவை.//
    என்று எவ்வாறு முடிவெடுத்தீர்கள் அதற்கு தான் அறிவியல் நிருபணம் கேட்டேன்.கருத்தியல் பொருளியல் என்று தான் சொல்லி கொண்டிருக்கின்றீர்களே தவிர அறிவியல் அளவுகோலில் பொருந்தாத கடவுளுக்கு இதுவரை நேரடியான பதில் இல்லை.,

    அடுத்து கம்யூனிஷம் குறித்து வருவோம்
    //சமூக ஏற்றத்தாழ்வுகள் நீடித்திருப்பதுவரை மதங்களும் நீடித்திருக்கும்//
    சமுக ஏற்றத்தாழ்வை குறித்து நான் பேசவில்லை., வழங்கப்படும் நீதி தர்க்கரீதியாக நீதமாக இருக்க வேண்டும் என்பதே என் கேள்வி அது கம்யூனிசத்தாலோ அல்லது ஏனைய மனித உருவாக்க சட்டங்களோ அது முடியாது என்பதற்கே அந்த சுட்டி.

    மறுபடி, மறுபடி., கம்யூனிஷம் படித்து பாருங்கள் என்று கூறாமல் தெளிவாக நேரடியாக பதில் தர முயற்சியுங்கள். ஏனெனில் நான் கம்யூனிஷ அடிப்படை சட்டங்கள் குறித்து தவறுதலாக கேள்வி எழுப்பவில்லை. (எனினும் கம்யூனிசம் குறித்து நான் அவ்வளவாக அறிந்தவன் இல்லை., இன்ஷா அல்லாஹ் அதை அறிந்தப்பின் கம்பூனிசம் குறித்து உங்களுடன் கருத்து பரிமாறிக்கொள்கிறேன்) மாறாக நான் அளித்த சுட்டியில் பாமரனுக்கு தோன்றும் எதார்த்த கேள்விகள் தான் நான் எழுப்பியுள்ளேன்.

    //மனிதனிடம் இருக்கும் ஒரே அடிப்படை பேரண்ட விதிகள் தான். அந்த விதிகளுக்கு உட்படாத எதுவும் கற்பனையானது, நம்பிக்கை அடிப்படையிலானது என்பதாகத்தான் இருக்க முடியும்.//

    குட்… இதுவரை வாதித்த எந்த இடத்திலும் நம்பிக்கை சார்ந்த விசயமாக நான் கடவுளை குறிப்பிடவில்லை., அந்த வார்த்தை கூற நூறு சதவீகித வாய்ப்பு எனக்கு இருந்த போதிலும். அப்படி சொன்னால் அதுக்குறித்து மேலும் நீங்கள் விவாதிக்க முடியாது. ஆனால் மேற்குறிப்பிட்ட அதே விதிகளை அடிப்படையாக வைத்து நான் கொடுத்த சுட்டிக்கு கம்யூனிஷ கொள்கை ரீதியாக பதில் தாருங்கள். அஃது உங்களால் தர முடியவில்லையென்றால்
    //விதிகளுக்கு உட்படாத எதுவும் கற்பனையானது, நம்பிக்கை அடிப்படையிலானது என்பதாகத்தான் இருக்க முடியும்// என்பதை நீங்களே தான் ஏற்றுக்கொண்டாக வேண்டும். சிரமம் வேண்டாம் அதே சுட்டியை இங்கும் இணைக்கிறேன்.
    http://iraiadimai.blogspot.com/2010/08/blog-post_15.html

    பதில் தர முயற்சியுங்கள்.

    இங்கு ஒரு துணை விசயம்., நானும் நீங்களும் ஒருவேறுபட்ட நாடுகளில் வசிப்பதால் கருத்து பரிமாற நேரம் நேர்கோணத்தில் அமையவில்லை.
    மேலும் நான் ஏற்கனவே கூறினேன். பின்னூட்டத்தால் எதையும் தெளிவாய் விவாதிக்க முடியாது ஏனெனில் மீண்டும் மீண்டும் ஒரே நிலைதான் இந்த பின்னூட்டம் வரை நம்மிடையை சுழற்சியாகி கொண்டிருக்கிறது அதற்கான தெரிதல்கள் நான் முதல் பின்னூட்டம் முதல் கொடுத்து தான் வருகிறேன்.

    ஆக முடிந்தால் எனது கருத்துக்கு எதிர்மறை கருத்துக்களை இங்கு ஆக்கமாக பதியுங்கள்., அதற்குண்டான பதிலை இன்ஷா அல்லாஹ் நானும் பதிகிறேன்.ஏனெனில் பக்கம் பக்கமாக நீங்கள் இடும் பின்னூட்டத்தால் ஆரம்பத்திலிருந்து-இறுதிவரை சீராக ஒரு வாதத்தை மட்டுமே முன்னிருத்தி எனக்கு பதிலளிக்க ஏதுவாக இல்லை. அத்தோடு ஏனையோரின் குறுக்கீடும் என்னை திசை திருப்பதான் செய்கிறது. ஆக நான் சொன்ன எளியமுறைகளில் முயற்சியுங்கள். எப்போது வேண்டுமானாலும் பதில் சொல்ல ஏதுவாக இருக்கும்.

    அடுத்து ஒரு விசயம் , இஸ்லாமிய தவறான புரிந்துணர்வுக்கு சான்று கேட்டீர்கள். யார் யாருடன் விவாதித்தது குறித்து ஒரு பட்டியல் தந்தேன். அதில் வினவையும் சேர்த்துக்கொள்ளுங்கள். அவர்களின் தளங்களில் பார்த்தால் அனேக இஸ்லாம் குறித்த தவறான புரிந்துணர்வு மற்றும் முரண்பாடுகள். அதற்கான பதில்கள் தான் என் அறிவுக்கு எட்டிய வரையில் நான் முஸ்லிம் தளம் முழுக்க பதிந்திருக்கின்றேன். இன்ஷா அல்லாஹ் மேலும் பதிவேன்., அதில் உங்களின் ஆக்கத்திற்கும் பதில் தரும் கட்டுரைகளும் அடங்கும். செங்கொடியின் சிறகுகள்., அவர் தளம் தாண்டி ஏனைய தளங்களின் மேலாகவும் விரிய தொடங்கட்டும்

    இப்பவும் பாருங்கள் .,
    நிதர்சன சான்று.,
    சகோ நிலா வின் பின்னூட்டம்.,
    சகோ நிலா உங்களுக்கும் சேர்த்து சொல்கிறேன் நான் முஸ்லிம் தள நாத்திக சிந்தனைக்கு எதிராக வரையப்பட்ட கட்டுரைக்கு பதில் தர முயற்சியுங்கள்.குறைந்த பட்சம் விமர்சிக்கும் பொருளின் மூலத்திற்கான ஆதார தரவுகளையாவது தாருங்கள்

    -இறை நாடினால் இனியும் சந்திப்போம்.

  59. //“பரிணாம கொள்கை அறிவியல் ( !!!!!!!!!!) பூர்வமானது என்று வாதிடும் நீங்கள் அந்த கொள்கையில் உள்ள ஓட்டை களை கண்டுகொள்ளாதது ஏன்?//

    உயிர்தளிப்பில் என்ன ஓட்டைகள் இருக்கின்றன? ஏதும் கிடையாது. உயிர்தளிப்பு என்னுடைய பதிவில் விளக்கியிருக்கிறேன்.
    http://rajasankarstamil.blogspot.com/search/label/%E0%AE%89%E0%AE%AF%E0%AE%BF%E0%AE%B0%E0%AF%8D%E0%AE%A4%E0%AE%B3%E0%AE%BF%E0%AE%AA%E0%AF%8D%E0%AE%AA%E0%AF%81

    படித்துவிட்டு எங்கே ஓட்டை இருக்கிறது என சொல்லவும்.

  60. //மனிதனிடம் இருக்கும் ஒரே அடிப்படை பேரண்ட விதிகள் தான். அந்த விதிகளுக்கு உட்படாத எதுவும் கற்பனையானது, நம்பிக்கை அடிப்படையிலானது என்பதாகத்தான் இருக்க முடியும்.//

    Yes. I agreed,

    27:75. there is not a Thing* Hidden** in the space or its planet mass,

    கடவுள்* மறைபொருள் அல்ல !

    மாறாக அமிலப்பரிசோதனைக்கு** தயார் ! ?

    quranist@aol.com

  61. நண்பர் குலாம்,

    என்ன சொல்ல வருகிறீர்கள் நீங்கள்? கடவுள் என்பது என்ன? கருத்தா? பொருளா? அல்லது இந்த இரண்டுமல்லாத ஒன்றா? இது தான் என்னுடைய கேள்வி. கடவுள் பேரண்டத்திற்குள் இல்லை. அதனால், பேரண்ட விதிகளோ, அறிவியலோ கடவுளுக்கு பொருந்தாது என்கிறீர்கள். சரி பேரண்டத்திற்கு வெளியில் இருந்து பேரண்டத்திற்குள் செயல்படுபவர் என்று எடுத்துக் கொண்டால், நான் அப்படி கூறவில்லை என்கிறீர்கள். உங்களின் நிலை தான் என்ன? கடவுள் பேரண்டத்திற்கு உள்ளே இருக்கிறாரா? அல்லது வெளியில் இருக்கிறாரா? கடவுள் இருக்கிறார் என்றால் எங்காவது அவர் இருந்து தான் ஆக வேண்டும். அதை நான் யூகிக்கக் கூடாது என்றால் நீங்கள் சொல்லிவிடுங்கள். எங்கிருக்கிறார்?

    நான் சுற்றி வளைக்க விரும்பவில்லை, போலி காரணங்களை தேட முற்படவில்லை, உங்கள் பதில்களிலிருந்து யூகிக்கவும் விரும்பவில்லை. நீங்களே தெளிவாக கூறிவிடுங்கள். கடவுள் என்றால் என்ன? அவர் அல்லது அது எங்கிருக்கிறார்/கிறது?

    கற்பனையானவை என்று நான் கூறியதை விவாதம் முடிவுறா நிலையில் அவ்வாறு கூறக்கூடாது என்கிறீர்கள். ஏன் கற்பனை என்று கூறுகிறேன் என்பதையும் நான் கூறியிருந்தேன், அதையும் நீங்கள் மேற்கோள் காட்டியிருக்கிறீகள். \\மனிதனிடம் இருக்கும் ஒரே அடிப்படை பேரண்ட விதிகள் தான். அந்த விதிகளுக்கு உட்படாத எதுவும் கற்பனையானது, நம்பிக்கை அடிப்படையிலானது என்பதாகத்தான் இருக்க முடியும்// இப்போது என்னையே கேட்கிறீகள் \\என்று எவ்வாறு முடிவெடுத்தீர்கள் அதற்கு தான் அறிவியல் நிருபணம் கேட்டேன்.கருத்தியல் பொருளியல் என்று தான் சொல்லி கொண்டிருக்கின்றீர்களே தவிர அறிவியல் அளவுகோலில் பொருந்தாத கடவுளுக்கு இதுவரை நேரடியான பதில் இல்லை// என்று. அதாவது அறிவியல் அளவுகோலில் பொருந்தாது என நீங்கள் கூறும் ஒன்றை மறுப்பதற்கு அறிவியல் நிரூபணம் என்ன? என்று என்னைக் கேட்கிறீகள். நீங்கள் என்ன சொல்கிறீர்கள் என்பது உங்களுக்காவது புரிந்தால் சரிதான். அறிவியலின்படி கடவுள் உண்டா? என்றால் ஒற்றை வரியில் முடித்துவிடலாம். நீடித்து, நிலைத்து இயங்கும் ஒரு ஆற்றல் இருக்க முடியுமா என்றால் இருக்க முடியாது என்பதே அறிவியலின் பதில். இப்போது என்ன சொல்வீர்கள்? அறிவியல் விதிகளுக்குள் கடவுள் அடங்கமாட்டார் என்றா?

    சரி, கடவுள் இப்பேரண்டத்திற்குள் நேரடியாக செயல்படவில்லை. சில உதவியாளர்களின் மூலம் செயல்படுகிறார். அவருக்கு எதிர்ப்பாளர்கள் இருப்பதாகவும் கற்பிக்கப்படுகிறது. என்றால் சதா இப்பேரண்டத்திற்குள் வந்து சென்று உலவிக்கொண்டிருக்கும் உதவியாளர்களும், பேரண்டத்திற்குள் வாழ்ந்து கொண்டிருக்கும் எதிர்ப்பாளர்களும் கூட அறிவியலில் அகப்படாத மர்மம் என்ன? என்றால் கடவுள் என்ற ஒன்று சில மனிதர்களின் நம்பிக்கையில் மட்டுமே வாழ்கிறார் வெளியில் இல்லை என்று கூறுவதில் என்ன தவறு?

    அடுத்து கடவுள் இருக்கிறார் என நம்பும் நீங்கள் அதை கடவுள் இருக்கிறார் என உறுதியாக கூறமுடியுமா? இதை நான் ஏற்கனவே கேட்டிருக்கிறேன். \\ஏனென்றால் முழுக்க முழுக்க நம்பிக்கை சார்ந்த ஒரு விசயத்தில் அறுதி முடிவு என்று எதையும் கூறமுடியாது. இந்த விசயத்தில் முரண்பாடான எதிரும் புதிருமான ஒரு நிலையை நீங்கள் எடுக்கிறீகள். கடவுள் எந்த விதிகளுக்கும் உட்பட வேண்டிய அவசியமில்லை, அதனால் அறிவியல் ரீதியாக நிரூபிக்க வேண்டிய அவசியமில்லை என்றால், அதை தோராயத்தன்மை கொண்டதாக, ஒரு நிலைபாடாக மட்டுமே கொள்ள முடியும். ஆனால் நீங்கள் கடவுள் என்பது உறுதியாக நிலவிக் கொண்டிருக்கும் ஒன்று என்று கூறுகிறீர்கள். உறுதியானது என்று நீங்கள் கூறவேண்டுமென்றாலே அங்கு வேறு வாய்ப்புகளின்றி நிரூபணம் இருந்தாக வேண்டும். கடவுள் இருப்பது உறுதி என்றால் ஏதாவது ஒரு வகையில் நிரூபணம் வேண்டும். நிரூபணம் இல்லை என்றால் அது தோராயத்தன்மை உடையதாக இருந்தாக வேண்டும். இரண்டில் எது சரி?//

    அடுத்து, அறிவியல் விதிகளின்படி கற்பனை என்று கூறினால் விவாதம் முடிவுக்கு வராத நிலையில் கற்பனை என்று எப்படி கூறலாம் என்று கேட்கிறீகள். இதே வழியில் இஸ்லாத்தை எதிர்த்து விமர்சனம் வைத்தால், அதை விமர்சனம், மாற்றுக் கருத்து என்று தானே எடுத்துக் கொள்ள வேண்டும். அதை மட்டும் எப்படி தவறான புரிதல் என்று உங்களால் கூறமுடிகிறது? போகட்டும், வேறு பதிவர்களோ, பின்னூட்டக்கார்களோ எழுதியதும் கூறியதும் ஒரு பக்கம் இருக்கட்டும், நீங்கள் குறிப்பிட்ட என்னுடைய தவறான புரிதல் எது என்பதை சுட்டிக் காட்டுங்கள், குறிப்பாக நம்மிடையேயான இந்த விவாதத்தில்.

    கம்யூனிசம் குறித்து பார்ப்போம், கம்யூனிசம் நம்பிக்கையை அடிப்படையாகக் கொண்டதல்ல, அறிவியல் ஆய்வுகளை அடிப்படையாகக் கொண்டது. அதன்படி, மனிதன் தொடக்கத்தில் வர்க்கமில்லாமல் இருந்து பின்னர் வர்க்கங்களாக பிரிந்து கிடக்கிறான். மனிதன் வர்க்கங்களாக பிரிந்து கிடக்கும் வரை அனைவருக்கும் ஒரே நீதி என்பது ஏமாற்றாகத்தான் இருக்கும். இதுவரை உலகம் கண்ட அரசுகள் அனைத்தும் -ஜனநாயகம், குடியரசு எனக்கூறப்படும் அனைத்து அரசுகளையும் உள்ளடக்கி- வர்க்க சர்வாதிகார அரசுகளே, இந்த அனைத்து அரசுகளும் வர்க்கமற்ற சமூகத்தை சிந்திக்கவோ, செயல்முறைப்படுத்தவோ இல்லை. அதேபோல சோசலிச அரசும் வர்க்க சர்வாதிகார அரசே, ஆனால் இதுவரை இருந்த அரசுகள் சிறுபான்மை வர்க்கங்களின் சர்வாதிகார அரசாகவே இருந்தன, சோசலிச அரசு மட்டுமே பெரும்பான்மை வர்க்கத்தின் சர்வாதிகார அரசாக இருக்கும். மட்டுமல்லாது சோசலிச அரசின் செயல்பாடுகள் மக்களை வர்க்கமற்ற சமூகத்தை நோக்கி அழைத்துச் செல்லும் விதமாகவும் இருக்கும். இறுதியில் வர்க்க பேதமற்ற கம்யூனிச சமுதாயத்தில் அனைத்து மக்களுக்கும் பொதுவான சமநீதி, சமவசதி, சமவாய்ப்புகளோடு, நீங்கள் சொர்க்கத்தில் கிடைப்பதாக நம்பிக் கொண்டிருக்கும் வாழ்வைவிட சிறந்ததான வாழ்வு இந்த பூமியிலேயே மக்களுக்கு கிடைக்கும்.

    \\வழங்கப்படும் நீதி தர்க்கரீதியாக நீதமாக இருக்க வேண்டும் என்பதே என் கேள்வி அது கம்யூனிசத்தாலோ அல்லது ஏனைய மனித உருவாக்க சட்டங்களோ அது முடியாது// இப்படி கூறியிருப்பதும் நீங்கள் தான், \\கம்யூனிசம் குறித்து நான் அவ்வளவாக அறிந்தவன் இல்லை// என்று கூறியிருப்பதும் நீங்கள் தான். அதாவது எது குறித்து உங்களுக்கு அவ்வளவாக தெரியாது என்று வாக்குமூலம் கொடுத்திருக்கிறீர்களோ அதால் முடியாது என்று உறுதியாக கூறுகிறீகள். தெளிவாகச் சொன்னால், இஸ்லாம் கம்யூனிசத்தை விட சிறந்தது என்று நீங்கள் கூறினால் உங்களுக்கு இஸ்லாமும் தெரிந்திருக்கிறது, கம்யூனிசமும் தெரிந்திருக்கிறது என்பது பொருள். ஆனால் கம்யூனிசம் எனக்கு தெரியாது என்று கூறிக்கொண்டே கம்யூனிசத்தைவிட சிறந்தது என்று கூறுகிறீர்கள். என்றால், அது தவறான கூற்று அல்லவா?

    பின்குறிப்பு: இந்த விவாதத்தை தனிப்பதிவாக இடச்சொல்லியிருக்கிறீர்கள். சில காரணங்களால் அதை தவிர்க்க விரும்புகிறேன். தொடக்கத்தில் நான் எழுதத் தொடங்கும் போது மத விவகாரங்களை 10 விழுக்காட்டுக்கு அதிகமாக எழுதக் கூடாது என்றுதான் திட்டமிட்டிருந்தேன். ஆனால் தற்போது அதைவிட அதிகமாகிவிட்டது. அதனால் தான் இஸ்லாம் குறித்த தொடரை முதலில் வாரத்திற்கு ஒன்றாக எழுதிக் கொண்டிருந்ததை மாத்\த்திற்கு ஒன்று என மாற்றியிருக்கிறேன். எனவே உங்கள் கோரிக்கையை ஏற்று தனிப்பதிவாக இட இயலாமலிருக்கிறேன். உங்களுக்கு ஆர்வமிருப்பின் ஒரு தலைப்பை தேர்ந்தெடுத்துக் கொண்டு தனி விவாதமாக நடத்துவோம். உங்கள் விருப்பத்தைக் கூறலாம். மற்றப்படி இங்குள்ள கட்டுரைகளை விவாதங்கலை படிப்பவர்கள் தங்கள் கருத்துக்களை கூறவிரும்பினால் அதை தடுப்பது சரியானதாக இருக்க முடியாது. ஆனால் அது எப்படி உங்களுக்கு இடையூறாக இருக்கிறது என்பது தான் புரியவில்லை.

  62. நண்பர் குலாம்,

    நிதியை மிஞ்சும் நீதி யாரிடம்? எனும் உங்கள் கட்டுரையில் நீங்கள் சமனற்ற முறையிலான ஓர் ஒப்பீடை செய்திருக்கிறீர்கள். ஒரு பக்கம் யதார்த்தமாக உலகில் நிலவுவதையும் மறுபக்கம் நம்பிக்கையையும் நிருத்தியிருக்கிறீகள். இரண்டு யதார்த்தமான சட்டங்களையோ அல்லது இரண்டு நம்பிக்கையான சட்டங்களையோ ஒப்பீடு செய்திருந்தால் அது சரியான ஒப்பீடாக இருந்திருக்கும்.

    இதற்கு நான் பதில் கூறுவதற்கு முன் சில அடிப்படைகளை நீங்கள் புரிந்து கொள்ள வேண்டியது அவசியம். மனிதச் சட்டங்களை நீங்களும் ஏற்கிறீர்கள் நானும் ஏற்கிறேன். அதாவது சரியா தப்பா எனும் கோணத்தில் அல்ல, நிலவுகிறது எனும் கோணத்தில். ஆனால் இறைச் சட்டம் என்பதை நீங்கள் மட்டுமே ஏற்கிறீர்கள், நான் ஏற்கவில்லை. இதற்கு நான் பதில் கூறவேண்டுமென்றால் நான் ஏற்காத ஒரு நிலைப்பாட்டை கற்பனையாக ஏற்றுக் கொண்டு பதிலளிக்க வேண்டியதிருக்கும். மட்டுமல்லாது, மனிதச்சட்டம் என்பது மரண தண்டனை, ஆயுள் தண்டனை, சிறைத்தண்டனை, இழப்பீடு, தண்டத்தொகை என பலவாறான குறிப்புகளை உள்ளடக்கியது. ஆனால் இறைச்சட்டமோ எல்லா அநீதிக்கும் நீதமான முறையில் தண்டனை வழங்கப்படும் எனும் ஒற்றைக் குறிப்பை மட்டுமே கொண்டது. எனவே மனிதச் சட்டம் என்பது குறிப்பான தன்மையையும், இறைச்சட்டம் என்பது தோராயமான தன்மையையும் கொண்டது. மனித வாழ்க்கை என்பது பூமியில் நிலவுவது. குற்றங்கள் என்பது பிறப்புக்கும் இறப்புக்கும் இடைப்பட்ட காலத்தில் மட்டுமே நிகழக்கூடியது. அந்தக் குற்றங்களுக்கான தண்டனையும் அந்த காலத்திற்குள்ளாகவே வழங்குவதை மனிதச் சட்டம் அடிப்படையாக கொண்டிருக்கிறது. ஆனால் இறைச் சட்டமோ உலகில் எப்படி இருந்தாலும் பரவாயில்லை என அவகாசமளித்து இறந்தற்குப் பிறகு தண்டனையளிப்பதை அடிப்படையாகக் கொண்டது. ஆக இரண்டுக்கும் இடையிலுள்ள மாறுபாடான கூறுகளை உள்வாங்காமல், இறைவன் படைத்தவன் மனிதன் இறையின் படைப்பு என்று நம்பிக்கை சார்ந்த தகுதியை உள்ளீடாகக் கொண்டு எழுப்பப்படும் கேள்விகளின் தொகுப்பே உங்களின் கட்டுரை. இதுபோன்ற காரணங்களால் இந்த ஒப்பீடு சரியானது அல்ல.

    இனி உங்கள் கட்டுரைக்கு வருவோம், உங்களின் ஒவ்வொரு கேள்விக்கும் தனித்தனியாக பதிலளிப்பது தேவையற்றது. மட்டுமல்லாது, அது ஒருங்கிணைந்த நோக்கத்தை சிதைக்கவும் செய்யும். எனவே, மனிதச் சட்டம் இறைச்சட்டம் ஓர் ஒப்பீடு எனும் அடிப்படையில் பார்ப்போம். மனிதச் சட்டம் குற்றங்களின் அடிப்படையில் அதிகபட்சம் மரணம் வரையில் தான் செல்ல முடியும். ஒரு கொலைக்கு மரண தண்டனை சரி என்றால் பத்து கொலை செய்தவனுக்கும் அதே மரண தண்டனை எப்படி நீதியாக இருக்க முடியும் என்பது தான் சாராம்சமான கேள்வி. இதுவே இறைச் சட்டம் என்றால், சொர்க்க நரகத்தில் மரணம் கிடையாது என்பதால் ஒரு கொலை செய்தவனுக்கு கொஞ்ச காலம் நரகம் பத்து கொலை செய்தவனுக்கு நீண்ட காலம் நரகம் என்பது சரியான நீதி போல் தோற்றமளிக்கலாம். தனிப்பட்ட பிரச்சனையை மட்டும் எடுத்துக் கொண்டால் தான் இப்படி சரியான நீதி போல் தோற்றமளிக்கும். ஒட்டு மொத்தமாக பார்த்தால் அது வெறும் தோற்றம் தான் என்பது புலனாகும்.

    முதலில் மனித நீதி, குற்றம் சாட்டப்பட்டவனுக்கு அவனுடைய தரப்பு வாதங்களை எடுத்து வைக்க வாய்ப்பு தரப்படுகிறது. அந்த வாதம் அவனுக்கு எதிராக சாட்டப்படும் குற்றத்தின், அல்லது பாதிக்கப்பட்டவர்களின் நோக்கில் எடுத்துவைக்கப்படும் வாதம், இரண்டையும் பரிசீலித்து தண்டனை தீமானிக்கப்படுகிறது. இந்த வாய்ப்பு இறைநீதியில் இல்லை. விசாரிக்கப்படுவார்கள் என்று பொதுவாக கூறப்பட்டாலும் அது தனித்தனி குற்றம் சார்ந்ததாய் இல்லாமல் ஒட்டு மொத்த வாழ்கையில் அவன் இறைவழிகாட்டல்களை ஏற்றானா? மீறினானா? என்பதாகத்தான் இருக்கும். அதேநேரம் தனிப்பட்ட முறையில் அவனது ஒவ்வொரு உறுப்பும் அவன் செய்தது குறித்து சாட்சி கூறும் என்று குறிப்பிடப்படுகிறது. எடுத்துக்காட்டாக உயிருடன் இருக்கும் போது கண்ணைக் கொண்டு என்னென்ன குற்றங்களில் ஈடுபட்டான் என்று கண் தனியாக சாட்சியமளிக்கும், தோலைக் கொண்டு என்னென்ன குற்றங்களில் ஈடுபட்டான் என்று தோல் தனியாக சாட்சியமளிக்கும், கையைக் கொண்டு என்னென்ன குற்றங்களில் ஈடுபட்டான் என்று கை தனியாக சாட்சியமளிக்கும், காலைக் கொண்டு என்னென்ன குற்றங்களில் ஈடுபட்டான் என்று கால் தனியாக சாட்சியமளிக்கும். சுருக்கமாகச் சொன்னால் ஒவ்வொரு உறுப்பும் அவனுக்கெதிராக அப்ரூவராக மாறி சாட்சியமளிக்கும். ஆக குற்றம் சாட்டப்பட்டவனின் வாதம் அலட்சியப்படுத்தப்பட்டு, அதற்கு எதிரான வாதங்கள் மட்டுமே ஏற்றுக் கொள்ளப்படும். ஆனால் மனித நீதியோ இரண்டு தரப்பையுமே கேட்டு முடிவெடுக்கிறது.

    மட்டுமல்லாது, இறைநீதியில் எல்லா உறுப்புகளுமே தனித்தனியாக சாட்சியளித்து குற்றம் உறுதி செய்யப்பட்டவுடன் யாருக்கு தண்டனை தனித்தனியான உறுப்புகளுக்கா? இல்லை ஒட்டுமொத்தமான அவனுக்கா? அவனிடமிருந்து உறுப்புகளை தனித்தனியாக பிரித்துவிட்டால் அவன் என்பது என்ன? மாறாக மனித நீதியில் ஒன்றுக்கு மேற்பட்டவர்கள் செய்யும் குற்றத்தில் ஒருவரோ, இருவரோ அப்ரூவராக மாறி குற்றத்தை ஒப்புக்கொண்டு வழக்கிற்கு உதவும் விதத்தில் அப்ரூவராக மாறினால் அந்த தன்மையையும் கருத்தில் கொண்டு அவர்களுக்கு தண்டனை குறைத்து வழங்கப்படும். இறைநீதி இந்த தன்மையில் குழப்பமாகவே இருக்கிறது.

    மனித நீதியில் விதிக்கப்பட்ட தீர்ப்பை எதிர்த்து முறையீடு செய்யும் வாய்ப்பு இருக்கிறது. இந்த வாய்ப்பு முறையாக பயன்படுத்தப்படுகிறதா? இல்லையா? என்பது வேறு விசயம். ஆனால் வழங்கப்பட்ட தீர்ப்பின் மீது அதிருப்தி எழுந்தால் அந்த தீர்ப்பை எதிர்த்து முறையீடு செய்யவோ போராடவோ முடியும். ஆனால் இறைநீதியில் ஒரு அடிமைத்தன்மையே நிகழ்கிறது. தீப்புக்கு எதிராக என்ன, தன்னுடைய தரப்பை எடுத்துவைக்கவே முடியாது. ஒரே தீர்ப்பு, சரியானதும், நிரந்தரமானதும் அதுவே. இது நீதிமுறைமையாக இல்லாமல் கட்டளை முறைமையாகவே இருக்கிறது.

    தான் நாடியவர்களை தண்டிக்கிறான் தான் நாடியவர்களை மன்னிக்கிறான் என்பது இறைநீதியிலிருக்கும் ஒரு குறிப்பு. எந்த அடிப்படையில் தண்டிப்பு? எந்த அடிப்படையில் மன்னிப்பு? என்று யாராவது கூறமுடியுமா? ஏன் குறிப்பிட்டோரை தண்டிக்கிறான் ஏன் குறிப்பிட்டோரை மன்னிக்கிறான், யாராவது விளக்கம் கேட்க முடியுமா? அவன் மன்னிக்கும் ஆட்களில் பத்துபேரை கொலை செய்தவன் இருந்தால், இது அநியாயம் என்று யாரேனும் குரல் கொடுக்க முடியுமா? என்றால் அது என்ன நீதி?

    ’அ’ ‘ஆ’ என்று இருவர் இறைநீதியின் முன்னே வருகிறார்கள். இதில் அ என்பவர் நாத்திக வழியில் இறையை மறுத்து ஆனால் எந்தக் குற்றமும் செய்யாமல் இயன்றவரை மக்களுக்கு உதவிகரமாக வாழ்ந்து மடிந்தவர். ஆ என்பவர் ஆத்திக வழியில் வணக்க வழிபாடுகளை தவறாமல் கடைப்பிடித்து ஆனால் கொலை கொள்ளை வட்டி முதலான கொடுங்குற்றங்களைச் செய்து மடிந்தவர். இந்த இருவருக்கும் என்ன தீர்ப்பு வழங்கப்படும்? அ என்பவர் என்றென்றும் நரகிலேயே தங்கியிருப்பார், ஆனால் ஆ என்பவரோ அவருடைய குற்றங்களுக்காக எவ்வளவு காலம் விதிக்கப்படுகிறதோ அதுவரை நரகில் இருந்துவிட்டு சொர்க்கத்திற்கு சென்றுவிடுவார். இதை நீதி என்று எப்படி கூறுவது?

    பொதுவாக நீதி முறைமை என்றாலே எந்த நிலையில் குற்றம் இழைக்கப்பட்டதோ அந்த நிலையிலேயே அதற்கான தண்டனையும் வழங்கப்பட வேண்டும். மனிதன் என்ற நிலையில் குற்றம் இழைத்துவிட்டு அதற்கான தண்டனை மனிதன் என்ற நிலையில் இல்லாமல் சொந்த சிந்தனையின்றி, சொந்த செயல்களின்றி, கேள்வி கேட்கவோ, விளக்கமளிக்கவோ அதிகாரமின்றி; அனுமதிக்கப்பட்டதை மட்டுமே செய்து, அனுமதிக்கப்பட்டதை மட்டுமே சொல்லி, மனிதன் என்ற நிலையிலிருந்து இழிந்து அடிமை நிலையில் செய்யப்படும் ஒன்றை நீதி முறைமை என்று எப்படி அழைப்பது?

    மேற்கண்ட என்னுடைய விமர்சனங்களை, கடவுளையும் மனிதனையும் ஒப்பிடக் கூடாது, யாரும் எள்ளளவும் அநியாயம் செய்யப்பட மாட்டார்கள் என்பன போன்ற சொல்லாடல்கள் மூலம் நீங்கள் கடந்து செல்லலாம். ஆனால் யதார்த்தமான நிலையும் நம்பிக்கையான நிலையும் ஒன்றுக்கொன்று வேறுபாடானது. ஒன்றுக்கு மாற்றாக மற்றொன்று ஆக முடியாது என்பதையும் நீங்கள் உணர்ந்து கொண்டே ஆகவேண்டும்.

    அரசாட்சி, சட்டங்களின் தேவை வர்க்கங்களின் தோற்றத்திலிருந்து தொடங்குகிறது. மனிதன் வர்க்கங்களாக, பகை வர்க்கங்களாக பிரிந்து கிடக்கும் வரை சட்டம் என்பது ஏதாவது ஒரு வர்க்கத்திற்கு சாதகமாகவே இருக்கும். இதில் மனிதச் சட்டம், இறைச்சட்டம் என்றெல்லாம் பேதம் ஒன்றுமில்லை. மெய்ப்பாட்டில் இறைச்சட்டம் என்று ஒன்று இல்லை. எல்லாம் மனிதச் சட்டங்களே. ஒரு வர்க்கத்தின் மேலாண்மையை அனைத்து வர்க்கங்களையும் ஏற்றுக் கொள்ள வைப்பதே சட்டத்தின் தலையாய பணி. அந்த வர்க்க மேலாண்மை எல்லை கடந்து போகும் போது கடவுளின், இறைச்சட்டத்தின் தேவை எழுகிறது. உலகின் அனைத்து மதங்களும் ஏதோ ஒருவிதத்தில் மறுமைக் கோட்பாட்டைக் கொண்டிருக்கின்றன. இதன் பொருள், நிலவில் இருக்கும் சட்டங்களை மீறி சென்று விடாமல் இருக்க பூமியில் அநியாயம் நிகழ்ந்தாலும் மறு உலகில், இறந்ததன் பிறகான உலகில் துல்லியமாக நீதி தீர்க்கப்படும் எனும் நம்பிக்கையை ஏற்படுத்துவது. இதுவும் இன்னபிறவும் சேர்ந்து தான் மதங்களாக உருக் கொண்டிருக்கின்றன.

    இந்த உலகில் மனிதனின் செயல்பாடுகள் வேறொரு உலகில் எதிரொலிக்கப் போவதில்லை. இங்கு மனிதன் செய்யும் அனைத்து செயல்களின் விளைவும் இந்த உலகிலேயே எதிர்விளைவுகளை ஏற்படுத்துகின்றன. மனித குலம் கடந்துவந்த பாதையை ஆய்ந்து பார்த்தால் அந்த எதிர்விளைவுகளின் தூண்டுதலால் மனிதன் வெகுண்டெழுந்து மாற்றங்களை ஏற்படுத்தியிருப்பது வெளிப்படையாகும். இதை கம்யூனிசம் ’புரட்சி’ எனும் சொல்லால் குறிப்பிடுகிறது. இதுவரை எழுந்த புரட்சிகளெல்லாம் ஆளும் வர்க்கங்களை மாற்றியிருக்கிறது. சட்டங்களை புதிய ஆளும் வர்க்கத்திற்கு ஆதரவாய் திருத்தியிருக்கிறது. இனியும் ஒரு புரட்சி நடக்கும். அது இதுகாறும் பெரும்பான்மை மக்களாய் இருந்திருந்தும் ஆளும் வர்க்கமாய் இருந்திராத உழைக்கும் வார்க்கத்திற்கு ஆதரவாய் சட்டங்களை மாற்றியமைக்கும். அப்போது இதுவரை காலம் ஒடுக்கப்பட்ட அவர்கள் சகித்திருந்த அனைத்து விளைவுகளுக்கும் எதிராக பழிதீர்க்கும். இதன் தொடற்சியான பயணத்தில் வர்க்கங்களை அழித்துச் சமப்படுத்தும். அதன் பிறகு மலரும் கம்யூனிச காலகட்டத்தில் நீங்கள் கற்பனையான நம்பிக்கையில் இருக்கும் நீதியைப் போலன்றி மெய்யான சமத்துவ நீதி சொர்க்கமோ, நரகமோ தேவையின்றி இந்த உலகத்திலேயே ஏற்படும்.

  63. உங்கள் மீதும் ஏகனின் சாந்தியும் சமதானமும் நிலவட்டுமாக
    சகோ செங்கொடி
    கடவுள் குறித்து நான் ஏற்கனவே தெளிவாக சொல்லி தான் இருக்கிறேன் சகோ., ஆனால் நீங்கள் தான் கருத்தியல் அல்லது பொருளியல் இதில் எதிலாவது கடவுள் வரவேண்டும் என்கிறீர்கள். அல்லது இதுவல்லாத மூலமாக இருந்தால் அது என்ன என்று கேட்கீறீர்கள். பரவாயில்லை மீண்டும் தொடர்கிறேன்.
    கடவுள் என்பவரை ஒரு உயரிய சக்தியாக கொண்டதாலே அவன் வணங்கக்கூடியவானாகிறான். ஆக எந்த ஒன்றீன் மூலத்தின் கீழ் ஒரு செய்கை வந்தால் அது எப்படி கடவுள் என்ற அஸ்த்தில் இருக்க முடியும். கடவுளின் இருப்பை வரையறுக்க முடிந்தால் அது எப்படி கடவுளாக இருக்க முடியும்? ஆக பகுத்தறிவு ரீதியாக வரையறை செய்ய முடியாத ஒரு உயரிய சக்தியை மட்டுமே கடவுளாக இருக்க முடியும். சரி ஒரு வாதத்திற்கு வைத்துக்கொள்வோம் கடவுள் என்பவர் பார்க்கும் பொருளாவோ அல்லது ஏற்கும் கருத்தாகவோ இருந்தால் அவரது இருப்பு உங்களுக்கும் தென்படும் எனக்கும் தென்படும். ஆக நமக்கிடையில் தெரிவாக தெரியும் அப்பொருள் அல்லது அந்த செய்கையை நீங்கள் கடவுளாக ஏற்றுக்கொள்வீர்களா…? கண்டிப்பாக மாட்டீர்கள் ஏனெனில் நமக்கு தென்படும் ஒன்றை நாம் கண்டிப்பாக வரையறை செய்ய முடியும். ஆக வரையறை செய்த ஒருபொருளை கடவுளாக ஏற்றுக்கொண்டால் அதற்கு பெயர் எப்படி சர்வ சக்தி பெற்றதாக கொள்ள முடியும். ஆக மனித கட்டுப்பாட்டுக்குள் வராத ஒரு நிலை தான் கடவுள் என்று சொல்ல வருகிறேன். உதாரணமாக விலங்கினங்கள் குறித்த செய்கையை மனிதன் தெளிவாக வரையறுத்து வைத்திருக்கிறான். ஆனால் அதன் எல்லா நிலைகளையும் ஆராய, அவற்றின் செயல்பாடுகள் முழுவதையும் துல்லியமாக அறிய மனிதன் அந்த குறிப்பிட்ட விலங்காக மாற வேண்டிய அவசியமில்லை.

    ஆக ஒரு செயல் குறித்த தகவல்களை முழுவதும் திரட்ட மனிதன் அச்செய்கையாக காட்சியளிக்க தேவையில்லை. இதே நிலை ஒப்பிட்டு நிலையில் கீழாக அதே விலங்கினம் மனிதன் குறித்த எல்லா தகவல்களையும் அதே உயிரின வளர்ச்சியிலிருந்து துல்லியமாக பெற முடியாது., நீங்கள் சொல்லலாம் மனிதனின் செயல்களை உணரும் விலங்குகளும் இருக்க தான் செய்கின்றன. நானும் ஏற்றுக்கொள்கிறேன். ஆனால் பொதுவாக எல்லா அஃறிணை உயிர்களின் சிந்தனையாலும் மனிதர்களின் எல்லா நடவடிக்கைகளையும் துல்லியமாக கணிக்க முடியாது., மனிதனை விட ஆய்வு ரீதியாவும் அறிவு ரீதியாகவும் சிந்தனை செய்வதில் பலஹீன படைப்பாக அத்தகைய உயிரினங்கள் படைக்கப்பட்டதே இதற்கு காரணம்., ஆக அவற்றால் கலவியல் ரீதியாக இன்பம் பெறுவதிலும், உணவிட்டலிலும், இன்னபிற தன்னின சமுகம் சார்ந்த செயல்களில் மட்டுமே அவை கவனம் இருக்கும் மாறாக மனிதன் கண்டறிந்த முற்போக்கு ரீதியான அறிவியல் கண்டுப்பிடிப்புகளை குறித்து அறிந்திருக்க முடியாது என்பதை விட அத்தகைய அதுக்குறித்த சிந்தனை அவைகளுக்கு ஏற்பட வாய்ப்பே இல்லை.,

    ஆக இங்கு படைப்பினங்களின் படைப்பு நிலைக்கேற்ப சிந்திக்கும் திறனுடன் ஏனைய திறன்களும் வேறுப்படும். ஆக அஃறிணை உயிரினங்களின் சிந்தனை, பகுத்தறிவு என்ற ஓரறிவு கூடுதலாக கொண்ட மனித சிந்தனை தாண்டி எப்படி செயல்பட முடியாதோ, மனிதன் உட்பட ஏனைய உயிரினங்களின் செயல் திறத்தை முழுவதும் வடிக்கும், அனைத்து விதமான செயல்களை வரையறை செய்யும் மனிதனை விட ஒரு அளவிட முடியா அளவிற்கு அறிவார்ந்த சிந்தனை திறன் மிக்க கடவுள் எனும் ஒட்டுமொத்த உலகை நிர்ணயிக்கும் செய்கையின் மூலத்தை வரையறை செய்து எப்படி மனித சிந்தனையில் உருவான ஆய்வறிவில் கொண்டு வர முயற்சிப்பது பொருந்தும்????? அதுமட்டுமில்லாமல் கடவுளின் இருப்பை உணர்த்தும் குறீயிடுகள் மனிதனுக்கு அறிமுகமான வகையில் இருக்கவேண்டும் என்ற அவசியம் இல்லை.
    இப்போதும் சொல்கிறேன் கடவுள் ஒரு குறிப்பிட்ட இடத்தில், குறிப்பிட்ட நிலையில், குறிப்பிட்ட மூலத்தில் இருக்கிறார் என்ற வரைவிலக்கணம் தரப்பட்டால் ஒரு வேளை பதில் கிடைத்த திருப்தியில் அப்போது கடவுளை நீங்கள் வேண்டுமானல் ஏற்றுக்கொள்ளலாம் மனித செய்கைகளின் தெரிவுகளில் சிக்கும் அதை நான் கடவுள் என ஏற்றுக்கொள்ள மாட்டேன்
    கடவுள் குறித்த மூலத்தின் இருப்புக்கு இதுவே போதுமென்று நினைக்கிறேன்.

  64. ஒடுக்கப்பட்ட அவர்கள் சகித்திருந்த அனைத்து விளைவுகளுக்கும் எதிராக பழிதீர்க்கும். இதன் தொடற்சியான பயணத்தில் வர்க்கங்களை அழித்துச் சமப்படுத்தும். அதன் பிறகு மலரும் காலகட்டத்தில் நீங்கள் கற்பனையான நம்பிக்கையில் இருக்கும் நீதியைப் போலன்றி மெய்யான சமத்துவ நீதி சொர்க்கமோ, நரகமோ தேவையின்றி இந்த உலகத்திலேயே ஏற்படும்.

    008:039.And fight them all until there is no more oppression, and the entire system is for God.

    quranist@aol.com

  65. தொடர்ச்சி
    //அடுத்து, அறிவியல் விதிகளின்படி கற்பனை என்று கூறினால் விவாதம் முடிவுக்கு வராத நிலையில் கற்பனை என்று எப்படி கூறலாம் என்று கேட்கிறீகள். இதே வழியில் இஸ்லாத்தை எதிர்த்து விமர்சனம் வைத்தால், அதை விமர்சனம், மாற்றுக் கருத்து என்று தானே எடுத்துக் கொள்ள வேண்டும். அதை மட்டும் எப்படி தவறான புரிதல் என்று உங்களால் கூறமுடிகிறது? //

    கண்டிப்பாக இக்கருத்தை ஏற்றுக்கொள்ள முடியாது
    இன்று ஒரு செய்கை குறித்து அறிவியல் இதுவரை கண்டறிந்து மெய் என வாதிட்டதை மட்டுமே உண்மையென நம்பி அதன் அடிப்படையில் நாம் காரணம் தேடுகிறோம் மாறாக அதை தாண்டி ஒன்று செயல்பட வாய்பில்லை என்கிறோம். ஆனால் பிறிதொரு காலத்தில் இதை தாண்டி செயல்பட முடியாது வரையறை செய்த அச்செய்கையின் மாறுதலும் சாத்தியமே என ஒரு நிலை ஏற்பட்டால் ஏற்கனவே கண்டறிந்த சரியென்று நிருபணமான அறிவியல் சொல்வதை தாண்டி புதிதாக கண்டறிந்ததை நாம் ஏற்றுதான் கொள்கிறோம். ஆனால் அதுவரை ஏற்கனவே தெரிவுறுத்தப்பட்ட அறிவியல் பொய்யானது என்று சொல்வதில்லை மாறாக இது ஒரு அறிவியல் கண்டுப்பிடிப்பில் ஒரு மைல்கல் பெருமிதம் தான் கொள்கிறோம். இனி இச்செயலின் செய்கை சாத்தியமில்லை என வரையறுத்த அறிவியலும் இனி வரும் காலங்களில் மாறுபாடு அடையும் என்பதில் மாற்றுக்கருத்து இல்லை.
    ஆக நமக்கு சாதகமான சூழலில் சாதகமான பதிலை பதிவு செய்கிறோம்., உதாரணத்திற்கு உம்மத் வலைத்தளத்தில் மரணம் குறித்தே எனது கேள்விக்கு பதில் அளித்த ஒரு நாத்திக சகோதரர் இன்னும் சிறிது ஆண்டுகளில் மரணம் குறித்த தெரிதல்களை அறிவியல் கண்டுப்பிடித்து விடும் என்றார். ஆக நாத்திகர்களுக்கு எதிராக முன்னிருத்தப்படும் கேள்விக்களுக்கு அங்கு பதில் இல்லையென்றாலும் இனி வரும் காலங்கள் பதில் சொல்லி நகர்ந்து செல்வது எளிதாகிறது.ஆக ஏற்படும் மாற்றங்களுக்கான காரணத்தை மெல்ல மெல்ல அறிந்து மெய்படுத்துதலே அறிவியல். ஆக அறிவியல் சாந்த கருத்துக்களை நான் மட்டுமில்லை ஏனைய எல்லோரும் அதுக்குறித்து ஊகித்து சொல்லலாம். பின் நடைமுறை ஏற்றுக்கொள்ளும் புதிய விதியை ஏற்றுக்கொண்டு உண்மைப்படுத்தலாம்.

    ஆனால் இஸ்லாத்தை பொருத்த வரை அப்படியல்ல., அறிவியல் போல் நேரத்திற்கு கால சூழலுக்கு தகுந்தார்ப்போல் தம்முடைய கருத்துக்களை மாற்றவும் செய்யாது, நெகிழ்வு தன்மையும் அடையாது. மனித மூலங்களுக்கு மத்தியில் தெளிவான பிரகடனங்களை முன்னிருத்தி வாழும் வழிமுறை கையேடாக குர்-ஆன் தந்து இது எக்காலத்திற்கும் யாருக்காகவும் எதற்காகவும் மாற்றடைமடையாது என தெளிவாக முன்மொழிந்தே பின்னரே மனித சமுக மத்தியில் உலா வருகிறது., ஆக குர்-ஆன் குறித்த ஒன்றை குறை சொல்வது அறிவியலை குறை காண்பது போலாது., ஏனெனில் அறிவியல் தேவைகேற்ப தன் முகத்தை மாற்றிக்கொண்டே போகும். ஆனால் இறுதிமனிதர் இறக்கும் வரையிலும் அதே வசனங்கள், அதே ஏவல்கள்- விலக்கல்கள் ஆக இஸ்லாத்தை விமர்சிப்பவருக்கு நெகிழ்வடையாத குர்-ஆன் குறித்து முழுவதும் அறிந்து பின் விமர்சிக்கவேண்டும்.,

  66. தொடர்ச்சி –
    //சரி, கடவுள் இப்பேரண்டத்திற்குள் நேரடியாக செயல்படவில்லை. சில உதவியாளர்களின் மூலம் செயல்படுகிறார். அவருக்கு எதிர்ப்பாளர்கள் இருப்பதாகவும் கற்பிக்கப்படுகிறது. //
    உங்களின் இஸ்லாம் குறித்த தவறான புரிதலுக்கு என்ன சான்று என்று கேட்கீறீர்கள் மேற்கண்ட உங்கள் வரிகளே நல்ல சான்று., கடவுளுக்கு யார் உதவியாளர்கள்.. மலக்குகள் என்பவர்களை குறிப்பிடுகிறீர்களென நினைக்கிறேன். அதுப்போல எதிர்பாளர்கள்…? சைத்தான் எனப்படும் ஜின் வர்க்கத்தினை குறிப்பிடுகிறீர்களா சகோ நான் மீண்டும் சொல்வது என்னவென்றால்., குர்-ஆனில் எங்கெணும் மலக்குகள் உதவியாளர்கள் என்றோ சைத்தான்கள் எதிர்பாளர்கள் என்று குறிப்பிடப்பட்டீருக்கிறதா.. அல்லது சஹீஹான நபிமொழிகளில் அவ்வாறு குறிப்பிடப்பட்டிருக்கிறாதா…? மாறாக அவனுக்கு உதவியாளர்களோ எதிரிகளோ இல்லையென்றே கூறுகிறது
    பாருங்கள்.,
    http://iraiadimai.blogspot.com/2010/07/blog-post_08.html
    http://iraiadimai.blogspot.com/2010/11/blog-post_20.html

    இதுதான் வேண்டாம் என்கிறேன்.,ஆக ஒன்றை விமர்சிக்கும் அதன் மூலம் என்ன சொல்ல வருகிறது என்பதை நீங்கள் கொண்ட கருத்தில் பொருத்தி பின் மூன்றாம் நிலை ஆதார தரவுகளோடு தான் ஒப்பு நோக்க வேண்டும். மாறாக அந்த மூலத்தை , உங்களின் கருத்தால் தவறேனே வாதிட முடியாது.

  67. தொடர்ச்சி-
    //ஆனால் கம்யூனிசம் எனக்கு தெரியாது என்று கூறிக்கொண்டே கம்யூனிசத்தைவிட சிறந்தது என்று கூறுகிறீர்கள். என்றால், அது தவறான கூற்று அல்லவா?//
    உங்களின் தவறான புரிதலுக்கு இதுவும் நல்ல சான்று.,
    //ஏனெனில் நான் கம்யூனிஷ அடிப்படை சட்டங்கள் குறித்து தவறுதலாக கேள்வி எழுப்பவில்லை. (எனினும் கம்யூனிசம் குறித்து நான் அவ்வளவாக அறிந்தவன் இல்லை., இன்ஷா அல்லாஹ் அதை அறிந்தப்பின் கம்பூனிசம் குறித்து உங்களுடன் கருத்து பரிமாறிக்கொள்கிறேன்) மாறாக நான் அளித்த சுட்டியில் பாமரனுக்கு தோன்றும் எதார்த்த கேள்விகள் தான் நான் எழுப்பியுள்ளேன்.//
    இப்படி தான் சொன்னேன். இங்கு நான் கம்யூனிஸம் குறித்து கோட்பாட்டை குறித்து விவாதித்து அதில் ஏதேனும் முரண்படான கருத்தை சொல்லியிருந்தால் நீங்கள் சொல்லும் வாதம் சரி., ஆனால் நான் இங்கு கம்யூனிஸம் குறித்து கேள்வி எழுப்பவில்லை மாறாக கம்யூனிசம் குறித்து அறிந்த பின்னரே அதுக்குறித்து விவாதிக்கிறேன் என்று சொன்னேன் மேலும் // பாமரனுக்கு தோன்றும் எதார்த்த கேள்விகள் தான் நான் எழுப்பியுள்ளேன். // என்றே குறியீடை முன்னிருத்தி இங்கே பதிந்துள்ளேன். ஓகே உடன்பாட்டு அணுகுமுறையில் உங்கள் கருத்தை ஆதரிக்கிறேன்., நான் எழுப்பிய கேள்விகளுக்கு பதிலாக நீங்களோ கம்யூனிஸ பிறப்புக்குறித்தும் இருப்புக்குறித்துமே பேசுகிறீர்கள் அதிலும் அவை வர்க்கரீதியில் எவ்வாறு செயல்படுகிறது என்பதை குறித்து தான் அந்த பத்தி முழுக்க சொல்லி இருக்கிறீர்கள்.,
    அதில் //இறுதியில் வர்க்க பேதமற்ற கம்யூனிச சமுதாயத்தில் அனைத்து மக்களுக்கும் பொதுவான சமநீதி, சமவசதி, சமவாய்ப்புகளோடு, நீங்கள் சொர்க்கத்தில் கிடைப்பதாக நம்பிக் கொண்டிருக்கும் வாழ்வைவிட சிறந்ததான வாழ்வு இந்த பூமியிலேயே மக்களுக்கு கிடைக்கும்.//
    என்ற வார்தையை உண்மையாக்க வேண்டுமானால் நான் எழுப்பிய கேள்விகளுக்கு பதில் சரியாக மற்றும் தெளிவாக நீங்கள் தந்திருக்கவேண்டும். ஏனெனில் //கம்யூனிசம் நம்பிக்கையை அடிப்படையாகக் கொண்டதல்ல, அறிவியல் ஆய்வுகளை அடிப்படையாகக் கொண்டது. // என்றும் அறைக்கூவல் விடுக்கிறீர்கள் ஆக மேற்கண்ட கேள்விகளுக்கு உரிய பதிலை ஏற்கனவே கம்யூனிஸம் தெரிவு செய்து இன்றளவும் அனைத்து உயிர்களுக்கும் வர்க்க பேதமற்ற முறையில் நடைமுறைப்படுத்தி இருக்கவேண்டும். ஆனால் இதுவரை அஃது ஏற்படுத்தாக முனையாத கம்யூனிசத்தை எப்படி //அனைத்து மக்களுக்கும் பொதுவான சமநீதி, சமவசதி, சமவாய்ப்புகளோடு// என்ற அளவுகோலில் பொருத்துகிறீர்கள்

  68. அடுத்து
    ., //அதாவது சரியா தப்பா எனும் கோணத்தில் அல்ல, நிலவுகிறது எனும் கோணத்தில். ஆனால் இறைச் சட்டம் என்பதை நீங்கள் மட்டுமே ஏற்கிறீர்கள், நான் ஏற்கவில்லை. //
    ஆக நடைமுறை வாழ்வில் நீதி அனைவருக்கும் சமமாக இருக்கவில்லை என்பதை நீங்களே ஏற்றுக்கொள்கிறீர்கள்., ஆக இதைத்தான் நான் கேட்கவருவது., ஏன் அத்த்கைய சமமற்ற தீர்ப்புக்கு காரணம்? நீங்கள் சொல்லலாம் உலகம் முழுவதும் ஒரே கொடையின் கீழ் கம்யூனிச ஆட்சி வரவில்லை என., சரி மீண்டும் உடன் பாட்டுமுறையில் ஏற்றுக்கொள்வோம். ஆனால் குறைந்த பட்சம் கம்யூனிச ஆட்சி நடைபெறும் நாடுகளில் கூட 1=1, 10=10 என்ற நான் குறிப்பிட்ட நடைமுறை சாத்தியக்கூறுகளை ஏற்படுத்த முடியவில்லையே..?
    அடுத்து உடனே நீதிமுறைமைக்கு கடவுள் குறித்த கண்ணோட்டதிற்கு சென்றுவீட்டீர்கள்.,
    அதிலும் //இதற்கு நான் பதில் கூறவேண்டுமென்றால் நான் ஏற்காத ஒரு நிலைப்பாட்டை கற்பனையாக ஏற்றுக் கொண்டு //
    ஆக கடவுள் என்பதை முதலில் கற்பனை என்கிறீர்கள். பின்னரோ அவர் வழங்கும் தீர்ப்பு குறித்து விமர்சிக்கிறீர்கள்?
    ஆக உங்களைப்பொறுத்த கடவுள் என்பது கற்பனையென்றால் நூறு சதவீகிதம் உலகவியல் ஆய்வின் அடிப்படையிலே நீதமான தீர்ப்பு வழங்குவது குறித்து தெளிவாக பதில் தரவேண்டும். ஆனால் பதிலுக்கு நீங்கள் கூறும் கடவுளும் தான் அநியாய தீர்ப்பு வழங்குகிறார் என்று கூறினால் கற்பனை கடவுள் என்ற நிலை தாண்டி அநியாயக்கார கடவுளாக இங்கு இருப்பை அறிந்துக்கொள்ள முடிகிறது
    ஆக உங்களைப்பொருத்தவரை கடவுள் கற்பனையா…?
    அல்லது அநியாயமாக தீர்ப்பு வழங்கவும் கூடியவரா…? என்பதை தெரிவு செய்யுங்கள்.
    கைக்கு தண்டனையா…? காலுக்கு தண்டனையா…? இப்படி கடவுளின் தீர்ப்பில் அநியாயம் இருப்பதாக கற்பிக்க முயல்கிறீர்கள். கொம்பில்லாத ஆட்டை முட்டியதற்காக கொம்புள்ள ஆடும் இறை முன்பு பதில் சொல்ல வேண்டும் என்று இறையின் நீத தன்மை நபிமொழிகளில் வர்ணிக்கப்பட எப்படி தாங்களே அதைத்தொடர்ந்த சொல்லாடலில் கடவுளின் நீதத்தன்மையை நகைப்புக்குறியதாக ஆக்குகிறீர்கள்.,

    இதற்கு வலுச்சேர்ப்பதான ஒரு சான்றாக “நான் நாடியோரை மன்னிக்கவும்/ தண்டிக்கவும் செய்கிறான் என்ற வசனத்தை மேற்கோள் காட்டுகிறீர்கள். இவ்வசன நாம் ஒருவரின் புற செய்கை குறித்து பார்த்து இவருக்கு இறைவன் தண்டனையோ அல்லது மன்னிப்போ கொடுப்பான் என்று நாமே சுயமாக ஒரு முடிவு எடுக்கக்கூடாது அது இறைவனின் வல்லமையின் கீழ் வருகிறது என்பதே பொருள்ப்படும். மேலும் இவ்வசனத்திலோ அல்லது வேறு எந்த ஒரு வசனத்திலோ மன்னிக்கப்படும் குற்றமாக விபச்சாரம், வட்டி, கொலை, அடுத்த்வரின் சொத்தை அபகரிப்பு, போன்ற கொடிய செயல்கள் வகைப்படுத்தப்படவில்லை. மாறாக மேற்குறிய குற்றங்களுக்கு அதிகப்படிய தண்டனை தருவதாகவே பணிக்கிறது., மேலும் அதைத்தொடர்ந்த சொல்லாடல்கள் எல்லாம் உங்கள் ஊகங்களின் அடிப்படையில் அமைந்தவை., சகோ நான் மீண்டும் சொல்கிறேன்

    இஸ்லாத்தை விமர்சிப்பதாக இருந்தால் ஆதார மூலங்களை தந்து விவரிக்கவேண்டும். அஃதில்லாமல் ஊகத்தில் அமைந்ததாக இருந்தால் விமர்சிக்க முடியாது மாறாக கேள்விகளாகவோ அல்லது சந்தேகமாகவோ தான் முன்னிருத்தப்பட வேண்டும். இதற்கான பதில் இறை நாடினால் இன்னும் சொல்ல தயாராக இருந்தும் விரிவஞ்சி “அந்நாளில் எந்த ஒரு ஆத்மாவுக்கும் அணுவேணும் அநியாயம் செய்யப்பட மாட்டது என்ற ஒரு வசனமே போதுமானது இறையியல் நீதியை அறிய என கருதுகிறேன், ஏனெனில்
    மேலும் உங்கள் சொல்லாடல்களில் கடவுள் செலுத்தும் நீதியிலும் குறைப்பாடுடையது என்று நீங்கள் வாதிட்டால் கடவுளின் இருப்பை நீங்கள் உறுதிப்படுத்துகிறீர்கள் என்பது உண்மையாகிறது. ஆக தான் சொல்வற்றை நியாயப்படுத்த கற்பனையெனும் நிலைத்தாண்டி இப்போது கடவுளின் நீத்ததை விமர்சித்து கம்யூனிசத்தை நியாயப்படுத்தலில் என்ன ஒரு அநியாயம்??? ஒருவேளை., பாருங்கள் கடவுளே மறுமையில் தவறான நீதி வழங்க அதிக வாய்ப்புள்ளது மாறாக இவ்வுலகத்தில் கம்யூனிசத்தால் மட்டுமே அனத்திற்கும் நீதிமான நீதி செலுத்த முடியும் என வழங்கப்பட்ட நீதிக்குறித்து பட்டியலிட்டால் அதிலாவது ஒரு நியாயம் இருக்கிறது.

  69. //இறையின் படைப்பு என்று நம்பிக்கை சார்ந்த தகுதியை உள்ளீடாகக் கொண்டு எழுப்பப்படும் கேள்விகளின் தொகுப்பே உங்களின் கட்டுரை. இதுபோன்ற காரணங்களால் இந்த ஒப்பீடு சரியானது அல்ல. //
    முற்றிலும் தவறான வாதம். நான் இங்கு எழுதும் எல்லா ஆக்கங்களிலும் கடவுளால் தான் முடியும் என்பதற்கு 50 சதவீகித வாய்ப்பும். அஃது பிற நிலைகளில் முடியாது என்பதற்கு 50 சதவீகித வாய்ப்பும் தந்து தான் எழுதுகிறேன். ஆக நம்பிக்கை சாந்த விசயம் என்பது இங்கு முக்கியமல்ல தர்க்கரீதியாக மனித உருவாக்க நீதிகளால் பதிலளிக்க முடியுமா முடியாதா என்பதை தான் பகிர்ந்திருக்கிறேன். ஆனால் கடவுளை ஏற்காத கடவுளை கற்பனையாக எண்ணும் நீங்கள் நூறு சதவிகித வாய்ப்பும் உலகவியலுக்கு கொடுத்து இங்கு விளக்கம் அல்லது விமர்சிக்க வேண்டும். மாறாக கடவுளை முன்னிருத்தி கடவுளாலும் அத்த்கைய நீதமான தீர்ப்பு வழங்க முடியாது என வாதத்தை திசைத்திருப்புகிறீர்கள்., ஆக நான் மீண்டும் கேட்பது இதுதான் ஒன்றுக்கு ஒன்று, பத்துக்கு பத்து என்ற அளவில் சம நீதி செலுத்துவது கூடும் என்பதை நீங்கள் நிறுபித்தாக வேண்டும் மாறாக அத்த்கைய நீதி செலுத்துவது சாத்தியமில்லை என்ற தோரணையில் எழுத்தை வடித்து இருக்கிறீர்கள். அதிலும் குறிப்பாக தீர விசாரிக்கப்பட்டே நீதி வழங்கப்படுகிறது என்கிறீர்கள்., இது தான் இங்கே மையக்கேள்வி., தீர விசாரிக்கப்பட்டு தீர்ப்பு வழங்கப்பட்ட போதிலும் நீதிமான தீர்ப்பு ஏன் வழங்க முடியவில்லை என்பது தான் இங்கு முக்கியம். ஆக ஒரளவு அல்லது 99 சதவீகிதம் நீதி வழங்கப்பட்டாலும் அது முழமைபெற்ற தீர்ப்பு வழங்கியது ஆகாது

    உண்மையாக கடவுள் என்ற ஒன்று இவ்வுலகில் இல்லாவிட்டால் இத்தகைய பதில் சொல்லா கேள்விகள் ஏற்படும் நிலை முதலில் இல்லாமல் செய்திருக்க வேண்டும். இயற்கை யாகவே உயிரிகள் தேர்வு செய்யப்பட்டிருந்தால் இப்படி கடவுளால் மட்டும் தான் முடியும் என்ற நம்பிக்கை சார்ந்த விசயமாக கொண்டால் தவிர நூறு சதவிகித திருப்திகரமான பதில் பெற முடியாது என்ற நிலைக்கு மாற்றமாகவும் பதில் தெளிவாக தந்திருக்க வேண்டும். இல்லாவிடில் இங்கு ஒரு முடிவுக்கு வந்தாக வேண்டும் ஒன்று, இதை தாண்டிய ஒரு நிலையால் தான் நூறு சதவிகித தீர்ப்பு வழங்க முடியும் அல்லது முழுவதும் நூறு சதவிகித தீர்ப்பு வழங்குதல் கம்யூனிசம் உட்பட மனித உருவாக்க சட்டங்களால் முடியாது ஆக இப்படி இரண்டில் ஒன்றை நாம் தெரிவு செய்ய வேண்டும்.,

    ,மேலும் இப்படி ஒரு உயிருக்கு பகரமாக பத்து உயிரை வாங்கியவனுக்கும் அதிகப்பட்சம் ஒரு உயிருக்கு உண்டான தண்டனை தருவது கூட தர்க்கரீதியாக ஏற்றுக்கொள்ள முடியாத வாதம்., ஆக அறிவியலும் தர்க்கமும் இந்த விசயத்தில் நூறு சதவிகிதம் 1=1 10=10 என தீர்ப்பு அளிக்க முடியும் என்று சொல்லும் வரைக்கும் மறைமுகமாக கடவுள் ஒன்றை ஆதாரிக்க தான் செய்கிறது.

    //அதை தடுப்பது சரியானதாக இருக்க முடியாது. ஆனால் அது எப்படி உங்களுக்கு இடையூறாக இருக்கிறது என்பது தான் புரியவில்லை.//
    நிச்சயமாக இடையுறுதான் சகோ. உதாரணத்திற்கு நீங்கள் என்னிடம் ஐந்தும் ஐந்தும் எவ்வளவு என கேட்கீறீர்கள்? அதற்கு பதில் தரும் முன் பிறிதொருவர் ஆறும் மூன்றும் சேர்த்தால் பத்து என்று சொன்னீர்கள் என்கிறார் ஆக இங்கு இரு வேறு கேள்விகளுக்கு நான் பதில் தரவேண்டும். ஆனால் ஒரே நேரத்தில். ஏனெனில் ஒன்றுக்கு பதில் தந்து பிறிதொன்றுக்கு பதில் தராவிட்டால் என்னைக்குறித்து இருவேறு கருத்துக்கள் இங்கு உலவ வாய்ப்பிருக்கிறது. ஒன்று என்னிடம் பதில் இல்லை மற்றொன்று நான் வேண்டுமென்றே புறகணித்தாக., எண்ணக்கூடும். என் கவனக்குறைவால் அல்லது நேரமின்மையால் அது விடுபட்ட போதிலும்.,

  70. இறுதியாக.,
    அல்ஹம்துலில்லாஹ்!! எல்லா விசயங்களையும் தொட்டு விட்டதாக அறிகிறேன்.ஆனால் இக்கருத்தில் சிலர் உடன்படலாம் சிலர் முரண்படலாம் அது அவரவர் உரிமை.
    இங்கு எதுவும் தெரிவுறுத்தப்பட்ட முடிவுகளல்ல மாறாக தர்க்க மற்றும் சிந்தனைரீதியான கருத்துப்பரிமாற்றங்களே., ஆக ஒருவர் எதை தேர்ந்துடுக்கிறார் என்பது அவரது மனம் அல்லது நடு நிலையை சார்ந்தது
    சகோதர் செங்கொடிக்கு மீண்டும் சின்ன நினையூட்டல்
    பின்னூட்டம் வாயிலாக எல்லா செய்கைகளையும்- தெரிதல்களையும் முழுவதும் விவாதிக்க முடியாது ஏனெனில் ஒரு பின்னூட்டம் எல்லா ஐயங்களையும் முன்னிருத்தியதாக இருக்க வாய்ப்பில்லை, மேலும் சில விசயங்களுக்கு முதலில் பதில் சொல்லும் போது ஏனைய முதல் பின்னூட்டத்தில் உள்ள முக்கிய நிகழ்வுகள் அத்தோடு நின்று போகிறது. மாறாக பின்னால் இடும் பின்னூட்டம் குறித்தே வாத-பிரதிவாதங்கள் தொடரக்கூடும். ஏன் இங்கு இதை அழுத்தமாக சொல்கிறேன் என்றால் நானும் வெளி நாட்டில் என் குடும்பத்திற்காக சுமார் 12 மணி நேரத்திற்கு மேலாக என் அலுவல் அமைந்திருக்கிறது. ஆக என்னால் தொடர்ந்து இணையத்தில் இணையமுடிவதில்லை., நான் முஸ்லிம் தளம் பார்த்தாலே உங்களுக்கு நன்றாய் தெரியும் மாத்திற்கு 3 ஆக்கம் உருவாக்குதல் என்பதே என் அதிகபட்ச டார்கெட்டாக இருக்கிறது., ஆக உங்களின் பக்கபக்கமான பின்னூட்டத்திற்கு ஒரு வேளை இணையத்தில் இணையாதால் பதில் தர தாமதமானால் என்னிடம் போதிய பதில் இல்லாததால் நான் பின்வாங்கியதாக நீங்களோ அல்லது பிறறோ தவறாக நினைக்கக்கூடும். ஆக இனி தொடர் பின்னூட்டத்தை என்னால் தொடரமுடியாது என்பதை இப்போதே வருத்தத்தோடு தெரிவித்துக்கொள்கிறேன். நான் உரையாடிய நாத்திக சிந்தனையாளர்களிலே கண்ணியமான உரையாடலை கேலி கிண்டலின்றி இறுதிவரை மேற்கொண்டவர் நீங்களும் ஒருவர் என்பதை இந்நேரத்தில் நினைவுகூறுகிறேன்

    ஆக இறை நாடினால் நான் ஏற்கனவே சொன்னதுப்போல என் கருத்துகளுக்கு உங்களின் மாற்றுக்கருத்தை ஒரு ஆக்கமாக பதிவு செய்யுங்கள் அல்லது நான்முஸ்லிம் தளத்திற்கு மறுப்பு என்ற குறீயிடுகளிலாவது பதிவு செய்யுங்கள்.இறை நாடினால் எனது ஓய்வு நேரங்களில் பார்வையிட்டு அதற்கான எனது மாற்றுக்கருத்துக்களை பதிகிறேன். ஆரம்பம் முதல் இப்போது வரை கண்ணியமான வார்த்தைகளை பயன்படுத்தியதாகவே அறிகிறேன். எனினும் என் வார்த்தைகள் உங்கள் மனதை புண்படுத்தும் விதத்தில் அமைந்திருந்தால் அதற்காக என்னை மன்னித்துக்கொள்ளுங்கள். நாளை உங்கள் மனதை புண்படுத்தியதற்காகவும் என் இறைவனிடம் நான் பதில் சொல்லியாக வேண்டும். உங்களுக்கு கண்டிப்பாக நன்றி சொல்லியே ஆக வேண்டும் என் இறையச்சம் மேலும் அதிகரிக்க உங்களோடு உரையாடிய பொழுதுகளும் ஒரு காரணம்.,

    உங்களது அகன்ற சிந்தனை உண்மையான தேடுதலின் பால் செல்ல இறைவனிடம் பிரார்த்தித்தவனாய்…விடைபெறுகிறேன்
    -இறை நாடினால் இனியும் சந்திப்போம்
    உங்கள் சகோதரன் குலாம்

  71. G u l a m, on செப்டம்பர்29, 2011 at 5:06 AM said:

    //இப்போதும் சொல்கிறேன் கடவுள் ஒரு குறிப்பிட்ட இடத்தில், குறிப்பிட்ட நிலையில், குறிப்பிட்ட மூலத்தில் இருக்கிறார் என்ற வரைவிலக்கணம் தரப்பட்டால் ஒரு வேளை பதில் கிடைத்த திருப்தியில் அப்போது கடவுளை நீங்கள் வேண்டுமானல் ஏற்றுக்கொள்ளலாம் மனித செய்கைகளின் தெரிவுகளில் சிக்கும்
    —————————————————————————————–
    அதை நான் கடவுள் என ஏற்றுக்கொள்ள மாட்டேன்//
    —————————————————————————————–

    புலனறிவுக்குறைபாடு பளிச்சிடுகிறது .

    025:044.

    Or do you think that most of them hear or comprehend?

    They are just like livestock.

    No, they are worse off.

    quranist@aol.com

  72. //குர்-ஆன் குறித்து முழுவதும் அறிந்து பின் விமர்சிக்கவேண்டும்.,//

    ஆம் ! வரிக்குவரி தவறான பதிலையே வாதமிடும் படைப்பியல் நம்பிக்கையாளருக்கும் டார்வினிய நம்பிக்கையாளருக்கும் இது மிகச்சரியாகப்பொருந்தும்.

    017:036.And do not uphold what you have no knowledge of. For the hearing, eyesight, and heart, all these* you are responsible for.

    sense*

    quranist@aol.com

  73. குலாம்,
    விசாரிக்கப்படும் அந்த நாளில், நான் ஏன் நாத்திகனானேன் என விளக்கமளிக்க மனிதனுக்கு வாய்ப்பு கொடுக்கப்படுமா?

  74. yousuf, on செப்டம்பர்30, 2011 at 4:34 AM said:

    விசாரிக்கப்படும் அந்த நாளில், நான் ஏன் நாத்திகனானேன் என விளக்கமளிக்க மனிதனுக்கு வாய்ப்பு கொடுக்கப்படுமா?
    —————————————————————————————–
    பொதுபுத்திக்கு:

    004:107.And do not argue on behalf of those who betray themselves.
    —————————————————————————————–

    அபயம்/உபயம்/வக்கீல் யார் ?

    004:109.Here you are arguing on their behalf in this world, but who will argue on their behalf with God on the Day of Resurrection?

    Or, who will be their sponsor?

    —————————————————————————————–
    தன்னிலை விளக்கமளிக்க வாய்ப்பு :

    016:111.The Day every soul will come to argue for itself, and every soul will be paid in full for what it did, and they will not be wronged.

    —————————————————————————————–
    திரிபுவாதிகளுக்கு:

    018:056.But those who reject will argue using falsehood to overshadow the truth with it. And they took My revelations and what they have been warned by for mockery!

    quranist@aol.com

  75. அன்புள்ளம் கொண்டவர்களே,

    அல்லாஹ் எப்படி பரிணாமவியலை அடித்து நொறுக்கியிருக்கிறான் என்று ஒரு பதிவு எழுதியுள்ளேன்

    பரிணாமவியலை அடித்து நொருக்கிய அல்லாஹ்..

    உங்கள் கருத்துக்களை தாருங்கள்

  76. நண்பர் குலாம்,

    ஒரு நிலைப்பாடு எடுத்து என்னுடன் விவாதிக்கத் தொடங்குபவர்கள் ஏன் இடையில் நிறுத்திக் கொள்கிறார்கள் என்பது குறித்து ஆராய வேண்டிய கட்டத்தில் நான் இருக்கிறேன். பின்னூட்டத்தில் முழுமையாக விவாதிக்க முடியாது என்று ஏன் கருதுகிறீகள் என எனக்கு புரியவில்லை. ஒருவேளை பிளாக்கர் தளம் போல குறைவான அளவில் தான் வோர்ட்பிரஸிலும் பின்னூட்ட முடியும் என நீங்கள் கருதியிருந்தால், வோர்ட்பிரஸ் நீளமான பின்னூட்டங்களை அனுமதிக்கும் என்பது உங்கள் கவனத்திற்கு. இதை நீங்கள் நூலகம் பகுதியில் இருக்கும் விவாதங்களில் காணலாம். தவிரவும் விவாதப்பகுதியில் குறிப்பான ஒரு தலைப்பில் விவாதிப்பது குறித்தும் எழுதியிருந்தேன். அதை ஏன் நீங்கள் பரிசீலனைக்கு எடுத்துக் கொள்ளவில்லை என்பது தெரியவில்லை. இணையத்தில் அதிக நேரம் செலவிட இயலாது என்றீர்கள். உண்மை தான், நானும் கூட ஒரு வெளிநாட்டில் என்னுடைய வேலை நேரம் போக, தவிர்க்கமுடியாத செயல்களுக்கான நேரம் போக ஏனைய நேரங்களில் தான் எழுதிக் கொண்டிருக்கிறேன். எவைகளைச் செய்யலாம், எவைகளைத் தவிர்க்கலாம் என பட்டியல் போட்டுவைத்துக் கொண்டுதான் எழுதிக் கொண்டிருக்கிறேன். பதில் கூறுவதற்கு நீங்கள் எடுத்துக் கொண்ட நேரத்தைவிட நான் அதிக நேரம் எடுத்துக் கொண்டிருக்கிறேன் என்பதையும் நீங்கள் கவனித்திருக்கலாம். பிறருடைய கருத்துகளுக்கு பதிலளிக்க நேரலாம் என்றும் கூறியிருக்கிறீகள். அவசியமில்லை. முதலிலேயே விவாதம் செய்பவரைத் தவிர ஏனைய யாருக்கும் பதிலளிக்க மாட்டேன் என்பதை வெளிப்படையாகவே அறிவித்துவிடலாம். விவாதங்களில் நான் பிற கருத்துகளுக்கு பதிலளிப்பதில்லை என்பதை வழக்கமாகவே வைத்திருக்கிறேன். அடுத்து, அப்படி பதிலளிக்கவில்லை என்றால் பதில் சொல்லத் தெரியாததால் தான் பதில் கூறவில்லை என்று நினைப்பார்கள் என்று கூறியிருக்கிறீர்கள். நிச்சயமாக நான் அவ்வாறு நினைப்பதில்லை. பிறர் அவ்வாறு நினைப்பதை நம்மால் தடுக்கவும் முடியாது. பதில் கூறினாலுமே கூட அவர்கள் அந்தப் பொருளில் நினைக்கக் கூடும். இந்த தளத்தில் அனேக கேள்விகளுக்கு நான் பதில் கூறாமல் கடந்து சென்றிருக்கிறேன். என்னைக்குறித்தும் அவர்கள் அவ்வாறு கருதியிருக்கக் கூடும். அதை நாம் பொருட்படுத்த வேண்டியதில்லை. ஏனென்றால் நம்முடைய நேரத்தை நாம்தான் ஒழுங்குபடுத்த வேண்டும். அடுத்து உங்கள் பதிவுகளுக்கு எதிர்பதிவு எழுதுவதில் எனக்கு மறுப்பு ஒன்றுமில்லை. ஆனால் நான் ஏற்கனவே கூறியபடி, இஸ்லாம் குறித்த விமர்சனப்பதிவுகள் நான் திட்டமிட்டிருந்ததை விட அதிகம் எழுதிக் கொண்டிருக்கிறேன். உங்கள் கட்டுரைகளையும் எடுத்துக் கொண்டு மறுப்பு எழுத வேண்டுமென்றால், இஸ்லாம் குறித்த தொடர், அதன் மறுப்புக்கு மறுப்பாக எழுதிவரும் தொடர் இரண்டில் எதாவது ஒன்று முடிந்த பிறகே உங்களின் கட்டுரைகளை எடுத்துக் கொள்ள முடியும்.

    இனி உங்கள் பதில்களுக்கு வருகிறேன். கடவுள் என்பதை அளக்க முடியாது, அளக்க முடிந்தால் அது கடவுளாக இருக்க முடியாது என்கிறீர்கள். இன்று மட்டுமல்ல இன்னும் எத்தனை உயரத்திற்கு மனிதனின் அறிதல் பயணப்பட்டாலும் கடவுளை அறிந்து கொள்ளும் எல்லைக்கு மனிதன் எட்ட முடியாது. அதாவது எக்காலத்திலும், எவ்வறிவாலும், என்ன செய்தாலும் கடவுளை அறியமுடியாது என்றால் அது நம்பிக்கை மட்டும் தான் அல்லவா? ஒருபோதும் அதை உறுதியாக நிலவுவதாக கொள்ள முடியாது. அப்படி கொள்வது அவரவர்கள் நம்பிக்கை சார்ந்தது. நீங்கள் ஒன்றைக் கவனிக்க வேண்டும், உங்களின் நம்பிக்கையை யாரும் இங்கு கேள்விக்கு உட்படுத்தவில்லை. மாறாக உங்களின் உறுதியைத்தான் கேள்விக்கு உள்ளாக்குகிறோம். கடவுள் இருக்கிறார் என்பது எங்கள் நம்பிக்கை என்றால் அங்கு எந்த விவாதத்திற்கு இடமில்லை. மாறாக கடவுள் உறுதியாக இருக்கிறார், அதை யாரும் பொய்ப்பிக்க முடியாது எனும் போதுதான் விவாதம் எழுந்துவருகிறது. விவாதம் என்று வந்த பிறகு அங்கு உங்கள் நம்பிக்கையைக் கூறி அதை ஏற்றுக் கொள்ளுங்கள் என்று கூற முடியாது. இதை உங்கள் எடுத்துக்காட்டினூடாக பார்க்கலாம்.

    ஒரு விலங்கு மனிதனின் உயரத்திற்கு எட்ட முடியுமா? மனிதனும் ஒரு சமூக விலங்கு எனும் அடிப்படையில் அவனுடைய அறிவும் சூழலின் உயரத்திற்கு ஏற்ப மட்டுமே இருக்க முடியும். அறிவு என்பதே அனுபவங்களிலிருந்து பெறும் படிப்பினையை சிந்தனை ரீதியாக செழுமைப்படுத்திக் கொள்வது தான். ஆகவே அறிவின் எல்லையில் விலங்கும் மனிதனும் வேறுவேறு தளத்திலேயே இருக்க முடியும். ஆனால் விலங்குக்கும் மனிதனுக்கும் இடையிலிருக்கும் வேறுபாடு மனிதனுக்கும் கடவுளுக்கும் இடையிலிருக்கும் வேறுபாட்டைப் போன்றதா? விலங்கு மனிதனை முழுமையாய் அறிந்து கொள்ள முடியாது ஆனால் ஒரளவிற்கேனும் அறிந்து கொள்ள முடியும். விலங்கின் மட்டத்தில் மனிதனின் இருப்பை ஐயப்பட யாதொரு நியாயமும் இல்லை. ஆனால் மனிதனின் மட்டத்தில் கடவுளை ஐயப்பட ஏராளமான முகாந்திரங்கள் கொட்டிக்கிடக்கின்றன. இதையே இன்னோரு கோணத்தில் பார்த்தால் விலங்கின் மட்டத்தில் மனிதனின் இருப்பை எந்த விதத்திலும் அறிந்து கொள்ள முடியாத நிலை இருப்பதாகக் கொண்டால் அப்போது மனிதனின் இருப்பிலோ இல்லாமையிலோ விலங்கின் வாழ்வில் என்ன தாக்கம் ஏற்படும்? ஒன்றுமில்லை. இதையே மனிதனின் மட்டத்தில் பொருத்தினால், எந்த விதத்திலும் அறிந்து கொள்ள முடியாத நிலையிலிருக்கும் கடவுள் என்ற ஒன்று, மனிதனின் எல்லா அசைவுகளையும் தீர்மானிக்கும் ஒன்றாக சுட்டப்படுகிறது. இது தான் பிரச்சனை ஏற்படும் இடம். எல்லாவற்றையும், கட்டுப்படுத்தும், ஆற்றலுள்ள, எல்லாவற்றையும் தீர்மானிக்கும் தகுதியுள்ள ஒன்று சிலரின் நம்பிக்கைக்குள் மட்டுமே நிலவும் ஒன்றாக இருப்பது தான் பிரச்சனை. அப்படி ஒன்று மெய்யாகவே இருந்து எந்தவிதத்திலும் அது மனிதனால் அறியப்பட முடியாது என்பதாயின் அந்த ஒன்றின் தாக்கமும் மனிதனுக்கு இருக்க வேண்டிய அவசியமில்லை அல்லவா?

    கடவுளின் இருப்பு ஏதாகிலும் ஒருவிதத்தில் அறியப்படுமாயின் அது அந்த கடவுளின் மதிப்புக்கு இழுக்கா? விலங்குகளை விட மனிதன் நிச்சயம் உயர்ந்தவன் தான், ஏன் மண்புழுவைவிட அற்பமான ஒன்றைக் கூட எடுத்துக் கொள்ளலாம். மண்புழுவால் அறியப்படும் நிலையில் மனிதன் இருக்கிறான் என்பது, மனிதனின் ஆற்றலுக்கு எந்தவிதத்திலாவது குறைவேற்படுமா? மனிதனின் அறிதல் எல்லைக்குள் கடவுள் இருப்பது அந்த மிகைத்த சக்தியின் ஆற்றலுக்கு ஒரு குறையும் இல்லை. ஆனால் கடவுளுக்கு இருப்பதாக மனிதன் கற்பித்து வைத்திருக்கும் தகுதிகளுக்கு மனிதன் அறியும் எல்லையில் கடவுள் இருப்பது தகுதிக் குறைவை ஏற்படுத்தும். இதுதான் மையப்புள்ளி, கடவுள் இருக்கிறதா இல்லையா என்பதைவிட மனிதன் அதற்கு கற்பித்திருக்கும் தகுதிகளுடன் கூடி கடவுள் இருக்கிறதா என்பது முக்கியத்துவம் வாய்ந்ததாகிறது. சுருக்கமாகச் சொன்னால், ஏதாவது ஒருவழியில், என்றாவது ஒரு நாள் கடவுள் அறியப்பட்டு விட்டால், இதுகாறும் மனிதன் கடவுளுக்கு அளித்து வந்திருக்கும் மதிப்பு நொடியில் இற்று வீழ்ந்துவிடும். அப்போது நீங்கள் இயேசுவுடன் உரையாடிய பாதிரியாரைப் போல் இருப்பீர்கள். இதை உங்களின் முத்தாய்ப்பு வசனம் வெகு துல்லியமாக படம் பிடித்துக் காட்டிவிட்டது. \\ஒரு வேளை பதில் கிடைத்த திருப்தியில் அப்போது கடவுளை நீங்கள் வேண்டுமானல் ஏற்றுக்கொள்ளலாம் மனித செய்கைகளின் தெரிவுகளில் சிக்கும் அதை நான் கடவுள் என ஏற்றுக்கொள்ள மாட்டேன்// ஆக இங்கு கடவுள் என்ற ஒன்றின் இருப்பைவிட அந்த கடவுளுக்கு மனிதன் தந்துவைத்திருக்கும் மதிப்பின் இருப்பே முக்கியமானது. இதற்குமேல் இதில் விவாதிப்பதற்கு ஒன்றுமில்லை என்றே கருதுகிறேன். நன்றி.

    இஸ்லாம் குறித்த விமர்சனங்களை விமர்சனம் மாற்றுக் கருத்து என்று கூறுவதா? தவறான புரிதல் என்று கூறுவதா? இதற்கு விளக்கமாக நீங்கள் கூறுவதென்ன? அறிவியல் மாறக்கூடியது ஆனால் இஸ்லாம் மாறாதது. எனவே, இஸ்லாத்திற்கு எதிராக விமர்சனமோ, மாற்றுக் கருத்தோ இருக்க முடியாது. எல்லாம் தவறான புரிதல் தான் என்கிறீகள். இது அடிப்படையிலேயே தவறானதாக இருக்கிறது. அறிவியல் என்பது மனிதன் தேடலின் ஆழத்தைப் பொருத்து மாறிக்கொண்டே செல்வது. பூமி மையக் கோட்பாடும் அறிவியல் தான், பரிதிமையக் கோட்பாடும் அறிவியல் தான். இப்படி மனிதனின் விருத்தியைக் கொண்டு மாறிக் கொண்டிருப்பதால் தவறான புரிதலுக்கு வாய்ப்பு ஏற்படுகிறது. கோபர்நிகஸை அறியாத யாரும் புவிமையக் கோட்பட்டை அறிவியலாகக் கருத இடமுண்டு. ஏனென்றால் மாற்றம் பெற்றிருப்பதை அவர் அறியவில்லை. ஆனால் நிலையாக இருக்கும் ஒன்றில் இதுபோன்ற தவறான புரிதல்கள் ஏற்படுமா? 1400 ஆண்டுகளுக்கு முன்பிருந்து இஸ்லாம் மாறவே இல்லை என்றால், அது ஒரே பொருளைக் கொண்டு தான் இருக்கும். ஒரே பொருளைக் கொண்டிருக்கும் ஒன்றில் தவறான புரிதல் ஏற்படுமா? அறிந்திருத்தல் அல்லது அறியாமலிருத்தல் எனும் இரட்டை நிலைதான் அங்கு ஏற்பட முடியும். தவறான புரிதலுக்கு அங்கு வாய்ப்பில்லை.

    இஸ்லாமியர்கள் கூறும் தவறான புரிதல் என்பதன் பொருளே அலாதியானது. அவர்கள் எதை தவறான புரிதல் எனக் கருதுகிறார்கள்? இஸ்லாம் குறித்து அவர்கள் என்ன கூறுகிறார்களோ அதை அப்படியே ஏற்றுக் கொள்ளாமல் எதிர்க்கேள்விகளை எழுப்பினால், மாற்றுப் பார்வையை முன்வைத்தால் அதை தவறான புரிதல் என்பார்கள். இதற்கு நீங்கள் கூறிய சான்றையே எடுத்துக் கொள்வோம். உதவியாளர்கள், எதிரிகள் என்று மலக்குகளையும், சைத்தான்களையும் கூறியது தவறான புரிதல் என்கிறீர்கள். அதாவது குரான் ஹதீஸ்களில் அந்தச் சொற்கள் பயன்படுத்தப்படவில்லை என்கிறீர்கள். ஆனால் சாராம்சத்தில் அவர்களின் செயல்பாடு என்ன? அல்லாவின் காரியங்களில் உதவி செய்வதும், அல்லாவுக்கு எதிரான பாதையில் மக்களை அணிதிரட்டுவதும் தான். இதைச் செய்பவர்களை உதவியாளர்கள் என்றும் எதிரிகள் என்றும் அழைப்பதில் என்ன தவறு இருந்துவிட முடியும்? இந்த வழியில் பார்த்தால் கடவுள் இல்லை எனக் கூறுவதும் தவறான புரிதல்தான். பின் எது சரியான புரிதல்? மலக்குகள், சைத்தான்கள் என்று அழைப்பதும், கடவுள் உண்டு என்று கூறுவதும் தான் சரியான புரிதல். கடவுள் ஏற்பு என்பது ஒரு நிலைப்பாடு, கடவுள் மறுப்பு என்பது மற்றொரு நிலைப்பாடு, இரண்டுமே தத்தமது கருத்துக்களை மாற்றுக்கருத்து, விமர்சனம் என்ற அடிப்படையில் தான் வைக்க முடியும். அதுதான் பொருத்தமானதும் கூட. ஆனால் என்னுடைய நம்பிக்கைக்கு வெளியில் இருப்பதை தவறான புரிதல் என்றால் சரியான புரிதலில் நிரூபனத் தன்மை இருந்தாக வேண்டும். சரியான புரிதல் என்று நீங்கள் கூறுவதே நம்பிக்கையின் அடிப்படையில் இருக்கும் போது, தவறான புரிதல் என்பது வலுவிழந்து போகிறது. எனவே, மற்றுக் கருத்து எனும் அடிப்படையில் அணுகுவதே சரியானது.

    \\கம்யூனிசம் எனக்கு தெரியாது என்று கூறிக்கொண்டே கம்யூனிசத்தைவிட சிறந்தது என்று கூறுகிறீர்கள். என்றால், அது தவறான கூற்று அல்லவா?// இதுவும் என்னுடைய தவறான புரிதலுக்கு சான்று என்று கூறியிருக்கிறீகள். நீங்கள் என்ன கூறிக் கொண்டிருக்கிறீர்கள் என்பதில் உங்களுக்கு உடன்பாடு இருக்கிறதா? இஸ்லாம் சிறந்தது என்று கூறினால் அது உங்களின் தனிப்பட்ட கருத்து, ஆனால் நீங்கள் ஒப்பீட்டு முறையில் கம்யூனிசத்தைவிட சிறந்தது என்று கூறுகிறீர்கள். அப்படியென்றால் உங்களுக்கு கம்யூனிசம் தெரிந்து அதைவிட இஸ்லாம் உயர்வாக தெரிந்தால் மட்டுமே உங்களால் அவ்வாறு கூறமுடியும். ஆனால் கம்யூனிசம் எனக்கு அவ்வளவாக தெரியாது என்றும் கூறுகிறீர்கள். கம்யூனிசம் குறித்து அவ்வளவாக தெரியாத நீங்கள் கம்யூனிசத்தைவிட இஸ்லாம் சிறந்தது என்று எப்படி கூறமுடியும்? ஆக உங்களுடைய தவறை சுட்டிக் காட்டினால் அதை என்மீது திருப்பியிருக்கிறீர்கள். இது சரியல்ல.

    மனிதநீதியா இறைநீதியா எனும் ஒப்பீட்டை முன்வைத்தது நீங்கள். அந்த உங்களின் ஒப்பீட்டை ஒரு வாதத்திற்காக ஏற்றுக் கொண்டு நான் பதிலளித்திருக்கிறேன். ஆனால் நீங்களோ நான் இருப்பை ஏற்றுக் கொண்டதைப் போல் புளகமடைகிறீர்கள். என்னென்ன காரணங்களால் இந்த ஒப்பீடு சரியல்ல என்பதை விளக்கிவிட்டே என்னுடைய பதிலைக் கூறியிருந்தேன். மட்டுமல்லாது உங்கள் பதிவின் சாரமே ஒப்பீட்டு முறையில் இறைநீதியே சிறந்தது என்று நிருவுவது. இதற்குத்தான் நான் அதே ஒப்பீட்டுமுறையில் மனிதநீதியைவிட இறைநீதி சிறந்ததல்ல எனக்காட்டியிருந்தேன். மனிதநீதியா? இறைநீதியா? எனும் கேள்வியை நீங்கள் எழுப்பவில்லை. இன்னும் உங்கள் இடுகையில் கம்யூனிச நீதி குறித்து விரிவாக பேசும் அளவுக்கு தேவை எதையும் நீங்கள் ஏற்படுத்தவில்லை. எனவே எந்த அளவுக்கு தேவையோ அந்த அளவுக்கு தரப்பட்டிருக்கிறது.

    கொலைக்கு என்ன தண்டனை களவுக்கு என்ன தண்டனை என்பதை விட சமூகத்தில் ஏன் குற்றம் நிகழ்கிறது? மனிதன் குற்றங்களை நிகழ்த்துவதற்கான சூழல் எதனால் தக்கவைக்கப்பட்டிருக்கிறது? என்ன வழிமுறைகளில் அதை நீக்குவது? இது தான் கம்யூனிசத்தின் பார்வை. குற்றங்களை தனிமனிதனுடன் மட்டும் முடிச்சுப் போடுவதில் பயனில்லை, சமூகத்திற்கும் அதில் பங்கிருக்கிறது என்கிறது கம்யூனிசம். எனவே தனிமனிதனுக்கான தண்டனையின் வாயிலாக குற்றங்களை குறைத்துவிட முடியாது. நடந்துவிட்ட குற்றத்திற்கான எதிர்விளைவு எனும் ரீதியில் மட்டுமே தண்டனைகளை பார்க்க முடியும். ஆக உலகில் நீங்கள் எப்படி வாழ்கிறீர்களோ அதன்படி இறந்தபின் தண்டனையோ வெகுமதியோ கிடைக்கும் எனும் இஸ்லாமின் கூற்றுக்கும், மனிதனை நல்லவனாக வாழவைக்கும் சூழலை ஏற்படுத்துவது எப்படி எனும் கம்யூனிசத்தின் சிந்தனைக்கும் இடையில் இருக்கும் வித்தியாசத்தை வெளிப்படுத்த வைக்க குறிப்பிட்ட அந்த உங்கள் இடுகையில் ஒன்றுமில்லை.

    கம்யூனிச நாடுகளில் அதை செயல்படுத்திக் காட்டியிருக்கலாமே என்று வினவுகிறீர்கள். கம்யூனிசம் செயல்படுத்தப்படும் வரை வர்க்க பேதமற்ற, குற்ற எண்ணம் நீங்கிய நல்லவர்களாக, சீரியசிந்தனை வாய்த்தவர்களாக மனிதர்களையும் சமூகத்தையும் மாற்ற முடியாது. ஆனால் இங்கு சில நாடுகளில் சோசலிசமே ஏற்பட்டது, மட்டுமல்லாது கம்யூனிசம் தனியொரு நாட்டில் ஏற்படவும் முடியாது.

    \\நான் இங்கு எழுதும் எல்லா ஆக்கங்களிலும் கடவுளால் தான் முடியும் என்பதற்கு 50 சதவீகித வாய்ப்பும். அஃது பிற நிலைகளில் முடியாது என்பதற்கு 50 சதவீகித வாய்ப்பும் தந்து தான் எழுதுகிறேன்// இரண்டுக்கும் என்ன வித்தியாசம். இது பாதி பாதி வாய்ப்பல்ல, மொத்தத்தின் இருவேறு பக்கங்கள். மனித உருவாக்க நீதி இறை நீதி எனும் உங்களின் பகுப்பே உங்கள் நம்பிக்கையை மட்டுமே காட்டுகிறது. மேலும், நான் ஊகித்துக் கொண்டு பதில் கூறுவதாகவும் கூறுகிறீகள். இஸ்லாமே 1400 ஆண்டுகளுக்கு முன் வாழ்ந்த ஒரு மனிதனின் ஊகம் என்பதே என் நிலைப்பாடு. மரணத்திற்கு மேல் எதையும் செய்ய முடியாது என்பதே எதார்த்தம். அந்த எதார்த்தத்தின் வழிப்பட்டு ஒரு குற்றவாளிக்கு வாழும் தகுதி இருக்கிறதா என்பதையே உலகின் சட்டங்கள் ஆராய்கின்றன. மாறாக எத்தனை கொலை செய்தான் என்பதை அல்ல.

    நன்றி. வாய்ப்பு கிடைக்கும் போது இது குறித்து விரிவாக அலசலாம்.

  77. […] கடவுளை நிரூபிப்பதற்கு அறிவியலைவிட தர்க்கமே சரியான வழி என நீங்கள் கூறியதும் அதனடிப்படையிலேயே கடவுள் நம்பிக்கை தவறு என்று என் மறுப்பு வாதங்களை வைத்தேன், பதிலளிக்க முடியாத இடம் வந்ததும் விட்டுவிட்டு வேறு கேள்விகளுக்கு நகர்ந்து விட்டீர்கள். அதற்கான சுட்டி இது […]

உங்கள் கருத்தின் மூலம் என்னை மேம்படுத்துங்கள்

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / மாற்று )

Twitter picture

You are commenting using your Twitter account. Log Out / மாற்று )

Facebook photo

You are commenting using your Facebook account. Log Out / மாற்று )

Google+ photo

You are commenting using your Google+ account. Log Out / மாற்று )

Connecting to %s

%d bloggers like this: